Rmu_sc0006087.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006087.1
OG0003287
Physical Location & Seq
Forward (+)
33054 .. 33731
678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006087.1_g000011.1.cds

Sequence Viewer

Length: 441 bp
atgggggagaattcaaacaatggaaagcgagagggacagaactccaaatccaaggccaattttgttggtgaaggaaaaggaggagacatggctaacctcccactttcacaaggggaatgtcagcaaatgatgggactattaaacaagatcaagaatggagctggcaactcaaatgaaggaagacaactattagagatgctgaattcatcaaccccttcaaccacaaatctcgttggtaacgttccaaattatgaagagatttcaggtacaatttgtgcactttcacaaaaggctacacaagtagtatggatatttgatagtggtgcgagtgaccacgtggacctttgctcggggacggtgattgggacgagagctgaacgtgaagggctatattgtctcacaatgccaaaggaaggaacatgcaacgtggtccatacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

146

Amino Acids

15.47

Weight (kDa)

5.36

Isoelectric Point (pI)

20.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 240
AcsI RAATTY 2 cut(s) 10, 202
AcvI CACGTG 1 cut(s) 337
AfaI GTAC 1 cut(s) 268
AfiI CCNNNNNNNGG 2 cut(s) 349, 413
AgsI TTSAA 2 cut(s) 15, 219
AloI GAACNNNNNNTCC 2 cut(s) 32, 64
AluBI AGCT 2 cut(s) 161, 374
AluI AGCT 2 cut(s) 161, 374
Alw21I GWGCWC 1 cut(s) 280
Alw26I GTCTC 2 cut(s) 78, 401
Alw44I GTGCAC 1 cut(s) 276
Ama87I CYCGRG 1 cut(s) 349
AoxI GGCC 1 cut(s) 54
ApaLI GTGCAC 1 cut(s) 276
ApoI RAATTY 2 cut(s) 10, 202
AspS9I GGNCC 2 cut(s) 340, 430
AsuHPI GGTGA 2 cut(s) 80, 370
AvaI CYCGRG 1 cut(s) 349
AvaII GGWCC 2 cut(s) 340, 430
BaeGI GKGCMC 1 cut(s) 280
BbrPI CACGTG 1 cut(s) 337
BbsI GAAGAC 1 cut(s) 187
Bbv12I GWGCWC 1 cut(s) 280
BccI CCATC 1 cut(s) 124
BcoDI GTCTC 2 cut(s) 78, 401
BfaI CTAG 1 cut(s) 439
Bme18I GGWCC 2 cut(s) 340, 430
BmeT110I CYCGRG 1 cut(s) 349
BmgT120I GGNCC 2 cut(s) 340, 430
BmsI GCATC 1 cut(s) 186
BpiI GAAGAC 1 cut(s) 187
BsaAI YACGTR 1 cut(s) 337
BsaJI CCNNGG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 2 cut(s) 349, 413
BseDI CCNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 2 cut(s) 349, 413
BseRI GAGGAG 1 cut(s) 96
BseSI GKGCMC 1 cut(s) 280
BshFI GGCC 1 cut(s) 56
BsiHKAI GWGCWC 1 cut(s) 280
BsiHKCI CYCGRG 1 cut(s) 349
BslFI GGGAC 4 cut(s) 48, 147, 367, 379
BslI CCNNNNNNNGG 2 cut(s) 349, 413
BsmAI GTCTC 2 cut(s) 78, 401
BsmFI GGGAC 4 cut(s) 48, 147, 367, 379
BsnI GGCC 1 cut(s) 56
BsoBI CYCGRG 1 cut(s) 349
Bsp1286I GDGCHC 1 cut(s) 280
Bsp143I GATC 1 cut(s) 147
BspANI GGCC 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 51
Bst4CI ACNGT 1 cut(s) 358
Bst6I CTCTTC 1 cut(s) 249
BstBAI YACGTR 1 cut(s) 337
BstC8I GCNNGC 1 cut(s) 163
BstKTI GATC 1 cut(s) 150
BstMAI GTCTC 2 cut(s) 78, 401
BstMBI GATC 1 cut(s) 147
BstNSI RCATGY 1 cut(s) 423
BstSLI GKGCMC 1 cut(s) 280
BstV2I GAAGAC 1 cut(s) 187
BsuRI GGCC 1 cut(s) 56
Cac8I GCNNGC 1 cut(s) 163
Cfr13I GGNCC 2 cut(s) 340, 430
Csp6I GTAC 1 cut(s) 267
CviAII CATG 2 cut(s) 88, 420
CviJI RGCY 6 cut(s) 56, 92, 161, 293, 374, 388
CviKI_1 RGCY 6 cut(s) 56, 92, 161, 293, 374, 388
CviQI GTAC 1 cut(s) 267
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 51
Eco47I GGWCC 2 cut(s) 340, 430
Eco72I CACGTG 1 cut(s) 337
Eco88I CYCGRG 1 cut(s) 349
EcoRI GAATTC 2 cut(s) 10, 202
EcoT14I CCWWGG 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 51
FaeI CATG 2 cut(s) 91, 423
FaiI YATR 6 cut(s) 89, 252, 307, 391, 421, 435
FaqI GGGAC 4 cut(s) 48, 147, 367, 379
FatI CATG 2 cut(s) 87, 419
FspBI CTAG 1 cut(s) 439
HaeIII GGCC 1 cut(s) 56
Hin1II CATG 2 cut(s) 91, 423
HphI GGTGA 2 cut(s) 80, 370
Hpy166II GTNNAC 2 cut(s) 278, 340
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 2 cut(s) 278, 340
HpyAV CCTTC 5 cut(s) 65, 170, 225, 377, 407
HpyCH4III ACNGT 1 cut(s) 358
HpyCH4IV ACGT 4 cut(s) 240, 336, 379, 426
HpyCH4V TGCA 2 cut(s) 278, 423
HpySE526I ACGT 4 cut(s) 240, 336, 379, 426
Hsp92II CATG 2 cut(s) 91, 423
Kzo9I GATC 1 cut(s) 147
LmnI GCTCC 1 cut(s) 158
LpnPI CCDG 2 cut(s) 147, 249
LweI GCATC 1 cut(s) 186
MaeI CTAG 1 cut(s) 439
MaeII ACGT 4 cut(s) 240, 336, 379, 426
MaeIII GTNAC 2 cut(s) 236, 329
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MboII GAAGA 2 cut(s) 192, 266
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 5 cut(s) 10, 58, 202, 247, 270
MnlI CCTC 3 cut(s) 25, 74, 107
MseI TTAA 1 cut(s) 140
NdeII GATC 1 cut(s) 147
NlaIII CATG 2 cut(s) 91, 423
NmuCI GTSAC 1 cut(s) 329
NspI RCATGY 1 cut(s) 423
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PmaCI CACGTG 1 cut(s) 337
PmlI CACGTG 1 cut(s) 337
Ppu21I YACGTR 1 cut(s) 337
Psp1406I AACGTT 1 cut(s) 240
PspCI CACGTG 1 cut(s) 337
PspPI GGNCC 2 cut(s) 340, 430
RsaI GTAC 1 cut(s) 268
RsaNI GTAC 1 cut(s) 267
SaqAI TTAA 1 cut(s) 140
Sau3AI GATC 1 cut(s) 147
Sau96I GGNCC 2 cut(s) 340, 430
SduI GDGCHC 1 cut(s) 280
SfaNI GCATC 1 cut(s) 186
SinI GGWCC 2 cut(s) 340, 430
Sse9I AATT 5 cut(s) 10, 58, 202, 247, 270
SspMI CTAG 1 cut(s) 439
StyI CCWWGG 1 cut(s) 51
TaaI ACNGT 1 cut(s) 358
TaiI ACGT 4 cut(s) 243, 339, 382, 429
TasI AATT 5 cut(s) 10, 58, 202, 247, 270
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseFI GTSAC 1 cut(s) 329
Tsp45I GTSAC 1 cut(s) 329
TspDTI ATGAA 3 cut(s) 189, 195, 267
VneI GTGCAC 1 cut(s) 276
VpaK11BI GGWCC 2 cut(s) 340, 430
XapI RAATTY 2 cut(s) 10, 202
XceI RCATGY 1 cut(s) 423
XspI CTAG 1 cut(s) 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.