pycom12g16440

transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
18757785 .. 18758268
484 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g16440.1

Sequence Viewer

Length: 318 bp
ATGCCGCAATCTTCAGTGCTGGAGGTCCAGCTTTGGAGGTTCCAACCAAAGAACAGCCCAGTCTGTATCCTGGGAGTGCTGTGGTTGTGCCTGCCTCTCCCTTCAACTTCTCCCTTGTTTAGTAGGGAAGGGTTAACCCATGTCATACATGTTGTTGGACCCAACATGAATCCACACAGACCAAATTGTTTGAACAATGACTATAGTAAAGGCTCAAAGTCACCCAAGGGAAGCGTTAAGAACCTGGAGGCAAAGCTGCCAGAGTCACAAGTTCATTCTGATGGTGCCTCTAGAAATCATTTTGCAAACAGGTCATGA

Protein Analysis

106

Amino Acids

11.61

Weight (kDa)

9.51

Isoelectric Point (pI)

67.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 284
AciI CCGC 1 cut(s) 5
AflIII ACRYGT 1 cut(s) 148
AgsI TTSAA 2 cut(s) 105, 193
AjnI CCWGG 2 cut(s) 69, 243
AluBI AGCT 2 cut(s) 31, 256
AluI AGCT 2 cut(s) 31, 256
ApeKI GCWGC 1 cut(s) 256
AspS9I GGNCC 2 cut(s) 25, 158
AsuHPI GGTGA 1 cut(s) 213
AvaII GGWCC 2 cut(s) 25, 158
BanI GGYRCC 1 cut(s) 284
BbvI GCAGC 1 cut(s) 243
BccI CCATC 1 cut(s) 275
BciT130I CCWGG 2 cut(s) 71, 245
BciVI GTATCC 1 cut(s) 77
BfaI CTAG 1 cut(s) 291
BfmI CTRYAG 1 cut(s) 202
BfuI GTATCC 1 cut(s) 77
BisI GCNGC 2 cut(s) 5, 257
BlsI GCNGC 2 cut(s) 6, 258
Bme1390I CCNGG 2 cut(s) 71, 245
Bme18I GGWCC 2 cut(s) 25, 158
BmgT120I GGNCC 2 cut(s) 25, 158
BmiI GGNNCC 3 cut(s) 41, 160, 286
BmrFI CCNGG 2 cut(s) 71, 245
BmrI ACTGGG 1 cut(s) 53
BmuI ACTGGG 1 cut(s) 53
BpmI CTGGAG 2 cut(s) 41, 266
BsaJI CCNNGG 2 cut(s) 70, 225
Bse1I ACTGG 1 cut(s) 59
BseBI CCWGG 2 cut(s) 71, 245
BseDI CCNNGG 2 cut(s) 70, 225
BseNI ACTGG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 243
BshNI GGYRCC 1 cut(s) 284
BspACI CCGC 1 cut(s) 5
BspHI TCATGA 1 cut(s) 314
BspLI GGNNCC 3 cut(s) 41, 160, 286
BspT107I GGYRCC 1 cut(s) 284
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 2 cut(s) 70, 225
BssT1I CCWWGG 1 cut(s) 225
Bst2UI CCWGG 2 cut(s) 71, 245
BstC8I GCNNGC 1 cut(s) 92
BstNI CCWGG 2 cut(s) 71, 245
BstNSI RCATGY 1 cut(s) 152
BstSCI CCNGG 2 cut(s) 69, 243
BstSFI CTRYAG 1 cut(s) 202
BstV1I GCAGC 1 cut(s) 243
BsuI GTATCC 1 cut(s) 77
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 92
CciI TCATGA 1 cut(s) 314
Cfr13I GGNCC 2 cut(s) 25, 158
CviAII CATG 4 cut(s) 140, 149, 166, 315
CviJI RGCY 4 cut(s) 31, 57, 213, 256
CviKI_1 RGCY 4 cut(s) 31, 57, 213, 256
Eco130I CCWWGG 1 cut(s) 225
Eco47I GGWCC 2 cut(s) 25, 158
EcoRII CCWGG 2 cut(s) 69, 243
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 4 cut(s) 143, 152, 169, 318
FaiI YATR 6 cut(s) 141, 146, 150, 167, 204, 316
FatI CATG 4 cut(s) 139, 148, 165, 314
Fnu4HI GCNGC 2 cut(s) 5, 257
Fsp4HI GCNGC 2 cut(s) 5, 257
FspBI CTAG 1 cut(s) 291
GluI GCNGC 2 cut(s) 5, 257
GsuI CTGGAG 2 cut(s) 41, 266
Hin1II CATG 4 cut(s) 143, 152, 169, 318
HincII GTYRAC 1 cut(s) 135
HindII GTYRAC 1 cut(s) 135
HinfI GANTC 2 cut(s) 169, 263
HpaI GTTAAC 1 cut(s) 135
HphI GGTGA 1 cut(s) 213
Hpy166II GTNNAC 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 280
Hpy188III TCNNGA 2 cut(s) 291, 315
Hpy8I GTNNAC 1 cut(s) 135
HpyAV CCTTC 2 cut(s) 111, 122
HpyCH4V TGCA 1 cut(s) 305
Hsp92II CATG 4 cut(s) 143, 152, 169, 318
KspAI GTTAAC 1 cut(s) 135
Lsp1109I GCAGC 1 cut(s) 243
MaeI CTAG 1 cut(s) 291
MaeIII GTNAC 2 cut(s) 219, 264
MboII GAAGA 1 cut(s) 3
MluCI AATT 1 cut(s) 184
MlyI GAGTC 1 cut(s) 272
MmeI TCCRAC 2 cut(s) 67, 136
MnlI CCTC 5 cut(s) 16, 30, 105, 241, 298
MseI TTAA 2 cut(s) 134, 237
MslI CAYNNNNRTG 1 cut(s) 279
MspR9I CCNGG 2 cut(s) 71, 245
MvaI CCWGG 2 cut(s) 71, 245
NlaIII CATG 4 cut(s) 143, 152, 169, 318
NlaIV GGNNCC 3 cut(s) 41, 160, 286
NmuCI GTSAC 2 cut(s) 219, 264
NspI RCATGY 1 cut(s) 152
PagI TCATGA 1 cut(s) 314
PciI ACATGT 1 cut(s) 148
PfeI GAWTC 1 cut(s) 169
PkrI GCNGC 2 cut(s) 6, 258
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PscI ACATGT 1 cut(s) 148
Psp6I CCWGG 2 cut(s) 69, 243
PspGI CCWGG 2 cut(s) 69, 243
PspN4I GGNNCC 3 cut(s) 41, 160, 286
PspPI GGNCC 2 cut(s) 25, 158
RseI CAYNNNNRTG 1 cut(s) 279
SaqAI TTAA 2 cut(s) 134, 237
SatI GCNGC 2 cut(s) 5, 257
Sau96I GGNCC 2 cut(s) 25, 158
SchI GAGTC 1 cut(s) 272
ScrFI CCNGG 2 cut(s) 71, 245
SetI ASST 6 cut(s) 27, 33, 41, 246, 258, 314
SfcI CTRYAG 1 cut(s) 202
SinI GGWCC 2 cut(s) 25, 158
SmiMI CAYNNNNRTG 1 cut(s) 279
Sse9I AATT 1 cut(s) 184
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 291
StyD4I CCNGG 2 cut(s) 69, 243
StyI CCWWGG 1 cut(s) 225
TasI AATT 1 cut(s) 184
TauI GCSGC 1 cut(s) 7
TfiI GAWTC 1 cut(s) 169
Tru1I TTAA 2 cut(s) 134, 237
Tru9I TTAA 2 cut(s) 134, 237
TscAI CASTG 1 cut(s) 21
TseFI GTSAC 2 cut(s) 219, 264
TseI GCWGC 1 cut(s) 256
Tsp45I GTSAC 2 cut(s) 219, 264
TspDTI ATGAA 2 cut(s) 182, 263
TspRI CASTG 1 cut(s) 21
VpaK11BI GGWCC 2 cut(s) 25, 158
XbaI TCTAGA 1 cut(s) 290
XceI RCATGY 1 cut(s) 152
XspI CTAG 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.