pycom15g29010

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
25598318 .. 25598727
410 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g29010.2

Sequence Viewer

Length: 270 bp
ATGGCTGCGATTCCCTGCAAGAACCTTGTTGTTGTGGCTTTGTTCTTGCTTTGTTTCATCTCAATCACAGCTCAAGGAAGGACTTTGGAATTGGGAGTTGTTAGTAAGGGAGCTGCTGATGCTCATCAGAAGAAGAGCCATGATCTTCATGACACTACCTTTAAACAGAAACAGGATGATGATCAAGGAGTAGTACTGCCAGACGAGAGTAATGATCTACTGGCTATGGATTACACTCCAGCAAGAAAAAAGCCTCCAATCCATAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.74

Weight (kDa)

6.38

Isoelectric Point (pI)

21.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 195
AluBI AGCT 2 cut(s) 71, 113
AluI AGCT 2 cut(s) 71, 113
ApeKI GCWGC 2 cut(s) 5, 113
BbvI GCAGC 1 cut(s) 100
BclI TGATCA 1 cut(s) 181
BisI GCNGC 2 cut(s) 6, 114
BlsI GCNGC 2 cut(s) 7, 115
BmcAI AGTACT 1 cut(s) 195
BmsI GCATC 1 cut(s) 109
BpmI CTGGAG 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 57
BsaBI GATNNNNATC 2 cut(s) 123, 180
Bse1I ACTGG 1 cut(s) 225
Bse8I GATNNNNATC 2 cut(s) 123, 180
BseGI GGATG 1 cut(s) 181
BseJI GATNNNNATC 2 cut(s) 123, 180
BseNI ACTGG 1 cut(s) 225
BseXI GCAGC 1 cut(s) 100
Bsp143I GATC 3 cut(s) 142, 181, 214
BspHI TCATGA 1 cut(s) 148
BspQI GCTCTTC 1 cut(s) 128
BsrI ACTGG 1 cut(s) 225
BssMI GATC 3 cut(s) 142, 181, 214
Bst6I CTCTTC 1 cut(s) 128
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 3 cut(s) 145, 184, 217
BstMBI GATC 3 cut(s) 142, 181, 214
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstV1I GCAGC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 181
CciI TCATGA 1 cut(s) 148
Csp6I GTAC 1 cut(s) 194
CviAII CATG 2 cut(s) 140, 149
CviJI RGCY 7 cut(s) 5, 38, 71, 113, 138, 224, 253
CviKI_1 RGCY 7 cut(s) 5, 38, 71, 113, 138, 224, 253
CviQI GTAC 1 cut(s) 194
DpnI GATC 3 cut(s) 144, 183, 216
DpnII GATC 3 cut(s) 142, 181, 214
DraI TTTAAA 1 cut(s) 163
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
FaeI CATG 2 cut(s) 143, 152
FaiI YATR 4 cut(s) 141, 150, 227, 264
FatI CATG 2 cut(s) 139, 148
FbaI TGATCA 1 cut(s) 181
Fnu4HI GCNGC 2 cut(s) 6, 114
FokI GGATG 1 cut(s) 188
Fsp4HI GCNGC 2 cut(s) 6, 114
GluI GCNGC 2 cut(s) 6, 114
GsuI CTGGAG 1 cut(s) 222
Hin1II CATG 2 cut(s) 143, 152
HinfI GANTC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 129
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 18
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
Hsp92II CATG 2 cut(s) 143, 152
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 3 cut(s) 142, 181, 214
LguI GCTCTTC 1 cut(s) 128
LmnI GCTCC 1 cut(s) 110
LpnPI CCDG 5 cut(s) 28, 158, 206, 213, 252
Lsp1109I GCAGC 1 cut(s) 100
LweI GCATC 1 cut(s) 109
MalI GATC 3 cut(s) 144, 183, 216
MboI GATC 3 cut(s) 142, 181, 214
MboII GAAGA 3 cut(s) 137, 142, 145
MluCI AATT 1 cut(s) 89
MnlI CCTC 1 cut(s) 264
MseI TTAA 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 3 cut(s) 142, 181, 214
NlaIII CATG 2 cut(s) 143, 152
PagI TCATGA 1 cut(s) 148
PciSI GCTCTTC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 10
PkrI GCNGC 2 cut(s) 7, 115
RsaI GTAC 1 cut(s) 195
RsaNI GTAC 1 cut(s) 194
SapI GCTCTTC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 162
SatI GCNGC 2 cut(s) 6, 114
Sau3AI GATC 3 cut(s) 142, 181, 214
ScaI AGTACT 1 cut(s) 195
SetI ASST 4 cut(s) 27, 73, 115, 161
SfaNI GCATC 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 1 cut(s) 89
TasI AATT 1 cut(s) 89
TatI WGTACW 1 cut(s) 193
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseI GCWGC 2 cut(s) 5, 113
TspDTI ATGAA 2 cut(s) 46, 137
ZrmI AGTACT 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.