Rw2G021550

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0002856
Physical Location & Seq
Forward (+)
29910542 .. 29911260
719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G021550.1

Sequence Viewer

Length: 186 bp
ATGACAACTACTGAAGCACGAAGTTTGGGAGTGGCGCCAAGTAATTATAGATCTGATGAGAAGAACCATGATGACAACTTGAAACATGGGATCAAAGAAGATGATGGAGTAGTGCCAGATGAGAGTAATGATTTACTGGCTATGGATTACACTCCAGCAAGTAAAAAGCCTCCAATCCACAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.74

Weight (kDa)

4.86

Isoelectric Point (pI)

42.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GLV1-2 PF21529 2 - 61 6e-15 Gloven 1/2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 34
AclWI GGATC 1 cut(s) 98
AcuI CTGAAG 1 cut(s) 33
AcyI GRCGYC 1 cut(s) 35
AgsI TTSAA 1 cut(s) 82
AlwI GGATC 1 cut(s) 98
AspLEI GCGC 1 cut(s) 37
BanI GGYRCC 1 cut(s) 34
BccI CCATC 1 cut(s) 98
BfoI RGCGCY 1 cut(s) 38
BglII AGATCT 1 cut(s) 50
BmiI GGNNCC 1 cut(s) 36
BpmI CTGGAG 1 cut(s) 138
BsaHI GRCGYC 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 141
BshNI GGYRCC 1 cut(s) 34
Bsp143I GATC 2 cut(s) 50, 90
BspLI GGNNCC 1 cut(s) 36
BspPI GGATC 1 cut(s) 98
BspT107I GGYRCC 1 cut(s) 34
BsrI ACTGG 1 cut(s) 141
BssMI GATC 2 cut(s) 50, 90
BssNI GRCGYC 1 cut(s) 35
BstACI GRCGYC 1 cut(s) 35
BstH2I RGCGCY 1 cut(s) 38
BstHHI GCGC 1 cut(s) 37
BstKTI GATC 2 cut(s) 53, 93
BstMBI GATC 2 cut(s) 50, 90
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
CfoI GCGC 1 cut(s) 37
CviAII CATG 2 cut(s) 68, 86
CviJI RGCY 2 cut(s) 140, 169
CviKI_1 RGCY 2 cut(s) 140, 169
DinI GGCGCC 1 cut(s) 36
DpnI GATC 2 cut(s) 52, 92
DpnII GATC 2 cut(s) 50, 90
Eco57I CTGAAG 1 cut(s) 33
EgeI GGCGCC 1 cut(s) 36
EheI GGCGCC 1 cut(s) 36
FaeI CATG 2 cut(s) 71, 89
FaiI YATR 4 cut(s) 48, 69, 87, 143
FatI CATG 2 cut(s) 67, 85
GlaI GCGC 1 cut(s) 36
GsuI CTGGAG 1 cut(s) 138
HaeII RGCGCY 1 cut(s) 38
HhaI GCGC 1 cut(s) 37
Hin1I GRCGYC 1 cut(s) 35
Hin1II CATG 2 cut(s) 71, 89
Hin6I GCGC 1 cut(s) 35
HinP1I GCGC 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 55
Hsp92I GRCGYC 1 cut(s) 35
Hsp92II CATG 2 cut(s) 71, 89
HspAI GCGC 1 cut(s) 35
KasI GGCGCC 1 cut(s) 34
Kzo9I GATC 2 cut(s) 50, 90
LpnPI CCDG 3 cut(s) 122, 129, 168
MalI GATC 2 cut(s) 52, 92
MboI GATC 2 cut(s) 50, 90
MboII GAAGA 2 cut(s) 73, 110
MflI RGATCY 1 cut(s) 50
MluCI AATT 2 cut(s) 43, 181
Mly113I GGCGCC 1 cut(s) 35
MnlI CCTC 1 cut(s) 180
MseI TTAA 1 cut(s) 184
NarI GGCGCC 1 cut(s) 35
NdeII GATC 2 cut(s) 50, 90
NlaIII CATG 2 cut(s) 71, 89
NlaIV GGNNCC 1 cut(s) 36
PluTI GGCGCC 1 cut(s) 38
PspN4I GGNNCC 1 cut(s) 36
PsuI RGATCY 1 cut(s) 50
SaqAI TTAA 1 cut(s) 184
Sau3AI GATC 2 cut(s) 50, 90
SfoI GGCGCC 1 cut(s) 36
SgeI CNNG 9 cut(s) 30, 51, 80, 91, 98, 128, 149, 167, 171
Sse9I AATT 2 cut(s) 43, 181
SspDI GGCGCC 1 cut(s) 34
TasI AATT 2 cut(s) 43, 181
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.