Rh2AG272000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0002856
Physical Location & Seq
Forward (+)
32390943 .. 32391296
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG272000.1

Sequence Viewer

Length: 246 bp
ATGGCTATAATACTATGCAAGCGTCTTGTTCTTTCTGTTCTTATCTTGGTTTTCTTCATCTCCATCACTGCTAGAGCAAGGAGTTTGCAAGTGGCACATAGCAGTAATGGAAGTGATCGTCAAAAAGGCATGGACTTTAAGTTTCCATCAAACCAAGATGATGTTCTTGATGGGACTACGGAGGAAGTAAATCTTGCGGATTACAGTCCGCCAAAGACACATCCTCCGTCTGCGATCTTGACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.89

Weight (kDa)

6.7

Isoelectric Point (pI)

50.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GLV1-2 PF21529 11 - 76 3.3e-10 Gloven 1/2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 197, 209
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
BccI CCATC 3 cut(s) 71, 154, 164
BfaI CTAG 1 cut(s) 72
BsaXI ACNNNNNCTCC 2 cut(s) 208, 238
BseGI GGATG 1 cut(s) 220
BslFI GGGAC 1 cut(s) 187
BsmFI GGGAC 1 cut(s) 187
Bsp143I GATC 2 cut(s) 115, 234
BspACI CCGC 2 cut(s) 197, 209
BssMI GATC 2 cut(s) 115, 234
Bst4CI ACNGT 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 243
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 2 cut(s) 118, 237
BstMBI GATC 2 cut(s) 115, 234
BtsCI GGATG 1 cut(s) 220
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 20
CseI GACGC 1 cut(s) 11
CviAII CATG 1 cut(s) 130
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 243
DpnI GATC 2 cut(s) 117, 236
DpnII GATC 2 cut(s) 115, 234
EciI GGCGGA 1 cut(s) 198
FaeI CATG 1 cut(s) 133
FaiI YATR 4 cut(s) 8, 16, 99, 131
FalI AAGNNNNNCTT 2 cut(s) 177, 209
FaqI GGGAC 1 cut(s) 187
FatI CATG 1 cut(s) 129
FokI GGATG 1 cut(s) 207
FspBI CTAG 1 cut(s) 72
HgaI GACGC 1 cut(s) 11
Hin1II CATG 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 167, 238
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 2 cut(s) 18, 88
HpyF3I CTNAG 1 cut(s) 243
Hsp92II CATG 1 cut(s) 133
Kzo9I GATC 2 cut(s) 115, 234
MaeI CTAG 1 cut(s) 72
MalI GATC 2 cut(s) 117, 236
MboI GATC 2 cut(s) 115, 234
MboII GAAGA 1 cut(s) 46
MnlI CCTC 2 cut(s) 175, 234
MseI TTAA 1 cut(s) 138
NdeII GATC 2 cut(s) 115, 234
NlaIII CATG 1 cut(s) 133
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 2 cut(s) 115, 234
SsiI CCGC 2 cut(s) 197, 209
SspMI CTAG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 206
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 2 cut(s) 194, 216
TspRI CASTG 1 cut(s) 73
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.