RchiOBHm_Chr5g0032441

Sterol 3-beta-glucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
26110773 .. 26112382
1610 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGTCATTTCTACCTAAAGATCAGAACTTTGTGAACCATTCATTGGCTGGAAAGAGTAAGAGCTTACGTTGTCACTTGGCTGAGAAGAATGTTTCCTATCTTCCAATTTCATCACCACCTGTTCTCTCTATCCATCAGAAACATGATACTACAGGTTCAAATTACTCTCTTTCTCTCATCATTCTCTCAAACTCTCAATATAATAGCATTTGTTTAAGAAATAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.4

Weight (kDa)

9.63

Isoelectric Point (pI)

47.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 43
AgsI TTSAA 1 cut(s) 159
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 105
BccI CCATC 1 cut(s) 141
BfmI CTRYAG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 43
Bsp143I GATC 1 cut(s) 19
BspCNI CTCAG 1 cut(s) 73
BssMI GATC 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 150
CviAII CATG 1 cut(s) 143
CviJI RGCY 3 cut(s) 47, 63, 80
CviKI_1 RGCY 3 cut(s) 47, 63, 80
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
FaeI CATG 1 cut(s) 146
FaiI YATR 2 cut(s) 144, 201
FatI CATG 1 cut(s) 142
Hin1II CATG 1 cut(s) 146
HphI GGTGA 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 24, 138
Hpy8I GTNNAC 1 cut(s) 34
HpyCH4IV ACGT 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 67
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 3 cut(s) 33, 132, 138
MaeII ACGT 1 cut(s) 67
MaeIII GTNAC 1 cut(s) 71
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 2 cut(s) 92, 97
MluCI AATT 2 cut(s) 105, 160
MseI TTAA 1 cut(s) 215
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 71
PflMI CCANNNNNTGG 1 cut(s) 43
SaqAI TTAA 1 cut(s) 215
Sau3AI GATC 1 cut(s) 19
SetI ASST 6 cut(s) 16, 65, 70, 121, 157, 227
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 5 cut(s) 60, 88, 131, 155, 165
Sse9I AATT 2 cut(s) 105, 160
TaiI ACGT 1 cut(s) 70
TasI AATT 2 cut(s) 105, 160
Tru1I TTAA 1 cut(s) 215
Tru9I TTAA 1 cut(s) 215
TseFI GTSAC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 30, 99
Van91I CCANNNNNTGG 1 cut(s) 43
XcmI CCANNNNNNNNNTGG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.