Rroxscaffold_3G00235450

UDP-sugar transporter

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
22461482 .. 22463926
2445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00235450.1

Sequence Viewer

Length: 183 bp
ATGGCCATGGTCTTTATCAACAAAGCTGTTCTTATGGAGTACTCGCATTCAATGACACTTCTCACTATGCAGGTTGCAAGTTACAAGGGCCAAGGAAGGATTGCAGAAGGATTGCAAGTTACAAGGGCCATGAAAGCTAAGATGCTAAAGAGTTTGTTCAAGAAATTCGCCAACCATCAATGA

Protein Analysis

60

Amino Acids

6.81

Weight (kDa)

10.29

Isoelectric Point (pI)

15.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 61
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 1 cut(s) 41
AgsI TTSAA 2 cut(s) 51, 160
AluBI AGCT 2 cut(s) 26, 137
AluI AGCT 2 cut(s) 26, 137
AoxI GGCC 3 cut(s) 3, 88, 126
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 2 cut(s) 88, 126
BalI TGGCCA 1 cut(s) 5
BfuAI ACCTGC 1 cut(s) 61
BmcAI AGTACT 1 cut(s) 41
BmgT120I GGNCC 2 cut(s) 88, 126
BmsI GCATC 1 cut(s) 132
BsaJI CCNNGG 2 cut(s) 6, 91
BseDI CCNNGG 2 cut(s) 6, 91
BshFI GGCC 3 cut(s) 5, 90, 128
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 3 cut(s) 5, 90, 128
Bsp19I CCATGG 1 cut(s) 6
BspANI GGCC 3 cut(s) 5, 90, 128
BspMI ACCTGC 1 cut(s) 61
BssECI CCNNGG 2 cut(s) 6, 91
BssT1I CCWWGG 2 cut(s) 6, 91
BstDEI CTNAG 1 cut(s) 138
BstDSI CCRYGG 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 134
BsuRI GGCC 3 cut(s) 5, 90, 128
BtgI CCRYGG 1 cut(s) 6
BveI ACCTGC 1 cut(s) 61
Cfr13I GGNCC 2 cut(s) 88, 126
Csp6I GTAC 1 cut(s) 40
CviAII CATG 2 cut(s) 7, 130
CviJI RGCY 5 cut(s) 5, 26, 90, 128, 137
CviKI_1 RGCY 5 cut(s) 5, 26, 90, 128, 137
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 138
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 6, 91
EcoT14I CCWWGG 2 cut(s) 6, 91
ErhI CCWWGG 2 cut(s) 6, 91
FaeI CATG 2 cut(s) 10, 133
FaiI YATR 4 cut(s) 8, 35, 68, 131
FalI AAGNNNNNCTT 2 cut(s) 15, 47
FatI CATG 2 cut(s) 6, 129
HaeIII GGCC 3 cut(s) 5, 90, 128
Hin1II CATG 2 cut(s) 10, 133
Hpy188III TCNNGA 1 cut(s) 160
HpyAV CCTTC 2 cut(s) 90, 101
HpyCH4V TGCA 4 cut(s) 70, 77, 104, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 2 cut(s) 10, 133
LpnPI CCDG 1 cut(s) 56
LweI GCATC 1 cut(s) 132
MaeIII GTNAC 2 cut(s) 80, 118
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 164
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
Mva1269I GAATGC 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 134
NcoI CCATGG 1 cut(s) 6
NlaIII CATG 2 cut(s) 10, 133
PctI GAATGC 1 cut(s) 46
PspPI GGNCC 2 cut(s) 88, 126
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
Sau96I GGNCC 2 cut(s) 88, 126
ScaI AGTACT 1 cut(s) 41
SetI ASST 3 cut(s) 28, 75, 139
SfaNI GCATC 1 cut(s) 132
Sse9I AATT 1 cut(s) 164
StyI CCWWGG 2 cut(s) 6, 91
TasI AATT 1 cut(s) 164
TatI WGTACW 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 146
XapI RAATTY 1 cut(s) 164
ZrmI AGTACT 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.