RchiOBHm_Chr5g0060551

ATP-dependent zinc metalloprotease FTSH 12

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
65654000 .. 65654696
697 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGGGGAGAAGGAAAAAAACTGGTGTTGATCGCTTCTCTCTCAGACAAGCTGTCATATTCATCTGTGCTACCAACATGCCAAATGAATTAGACCTTGAATTTGTTCGATCTAGACGTGTTGACCGTCGACTGTACATTGGTTTACCTGATGCAAAGTAG

Protein Analysis

52

Amino Acids

6.11

Weight (kDa)

10.81

Isoelectric Point (pI)

59.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 98
AfaI GTAC 1 cut(s) 134
AflIII ACRYGT 1 cut(s) 115
AgsI TTSAA 1 cut(s) 98
AhdI GACNNNNNGTC 1 cut(s) 50
AjiI CACGTC 1 cut(s) 116
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
ApoI RAATTY 1 cut(s) 98
ArsI GACNNNNNNTTYG 2 cut(s) 83, 115
Asp700I GAANNNNTTC 1 cut(s) 102
BfaI CTAG 1 cut(s) 111
BmeRI GACNNNNNGTC 1 cut(s) 50
BmgBI CACGTC 1 cut(s) 116
BmsI GCATC 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 25
Bsp1407I TGTACA 1 cut(s) 132
Bsp143I GATC 2 cut(s) 28, 107
BspCNI CTCAG 1 cut(s) 54
BsrGI TGTACA 1 cut(s) 132
BsrI ACTGG 1 cut(s) 25
BssMI GATC 2 cut(s) 28, 107
Bst4CI ACNGT 2 cut(s) 125, 132
BstAUI TGTACA 1 cut(s) 132
BstDEI CTNAG 1 cut(s) 41
BstKTI GATC 2 cut(s) 31, 110
BstMBI GATC 2 cut(s) 28, 107
BstNSI RCATGY 1 cut(s) 79
BtrI CACGTC 1 cut(s) 116
Csp6I GTAC 1 cut(s) 133
CviAII CATG 1 cut(s) 76
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 30, 109
DpnII GATC 2 cut(s) 28, 107
DriI GACNNNNNGTC 1 cut(s) 50
Eam1105I GACNNNNNGTC 1 cut(s) 50
FaeI CATG 1 cut(s) 79
FaiI YATR 2 cut(s) 56, 77
FatI CATG 1 cut(s) 75
FblI GTMKAC 1 cut(s) 127
FspBI CTAG 1 cut(s) 111
FspEI CC 6 cut(s) 6, 85, 93, 107, 123, 137
Hin1II CATG 1 cut(s) 79
HincII GTYRAC 2 cut(s) 121, 128
HindII GTYRAC 2 cut(s) 121, 128
Hpy166II GTNNAC 3 cut(s) 121, 128, 143
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 1 cut(s) 111
Hpy8I GTNNAC 3 cut(s) 121, 128, 143
Hpy99I CGWCG 1 cut(s) 129
HpyAV CCTTC 1 cut(s) 3
HpyCH4III ACNGT 2 cut(s) 125, 132
HpyCH4IV ACGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 1 cut(s) 115
Hsp92II CATG 1 cut(s) 79
Kzo9I GATC 2 cut(s) 28, 107
LpnPI CCDG 1 cut(s) 6
LweI GCATC 1 cut(s) 139
MaeI CTAG 1 cut(s) 111
MaeII ACGT 1 cut(s) 115
MalI GATC 2 cut(s) 30, 109
MboI GATC 2 cut(s) 28, 107
MluCI AATT 2 cut(s) 86, 98
MroXI GAANNNNTTC 1 cut(s) 102
NdeII GATC 2 cut(s) 28, 107
NlaIII CATG 1 cut(s) 79
NspI RCATGY 1 cut(s) 79
PcsI WCGNNNNNNNCGW 2 cut(s) 112, 121
PdmI GAANNNNTTC 1 cut(s) 102
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
SalI GTCGAC 1 cut(s) 126
Sau3AI GATC 2 cut(s) 28, 107
SetI ASST 4 cut(s) 52, 96, 118, 148
SfaNI GCATC 1 cut(s) 139
SgeI CNNG 6 cut(s) 33, 59, 88, 107, 123, 128
Sse9I AATT 2 cut(s) 86, 98
SspMI CTAG 1 cut(s) 111
TaaI ACNGT 2 cut(s) 125, 132
TaiI ACGT 1 cut(s) 118
TaqI TCGA 2 cut(s) 106, 127
TasI AATT 2 cut(s) 86, 98
TatI WGTACW 1 cut(s) 132
TspDTI ATGAA 2 cut(s) 49, 99
XapI RAATTY 1 cut(s) 98
XbaI TCTAGA 1 cut(s) 110
XceI RCATGY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 127
XmnI GAANNNNTTC 1 cut(s) 102
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.