RchiOBHm_Chr3g0484411

39S ribosomal protein L47

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
30785954 .. 30786798
845 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGTATTGCTTCAGTCGAAGTTGGAAGGCATCTGAACTGCGTCTGAAGTCCTGGGATGATCTCAATAAGCTATGGTTTGTCCTGCTTAAAGAGAAAAACATGCTGATGACTCAACGTCAGATGCTTCACGCACAGAATCTTCGTTTTCCTAATCCTGAGCGCCTTCCCAAAGTGAGGAAGTCAATGTGTCGTATCAAGCACGTACTCACTGAGAGAGCAATTGAAGAACCCGATTCCAGGAGGTCTGCTAAGATGAAGAGGATGATAAATGCGTTGTGA

Protein Analysis

92

Amino Acids

11.21

Weight (kDa)

10.57

Isoelectric Point (pI)

66.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MRP-L47 PF06984 5 - 72 3.6e-29 Mitochondrial 39-S ribosomal protein L47 (MRP-L47)
Ribosomal_L29 PF00831 11 - 72 1.8e-09 Ribosomal L29 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 65
AfaI GTAC 1 cut(s) 204
AfiI CCNNNNNNNGG 2 cut(s) 174, 237
AgsI TTSAA 1 cut(s) 224
AhdI GACNNNNNGTC 1 cut(s) 114
AjnI CCWGG 2 cut(s) 50, 236
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
AspLEI GCGC 1 cut(s) 162
BciT130I CCWGG 2 cut(s) 52, 238
BfoI RGCGCY 1 cut(s) 163
Bme1390I CCNGG 2 cut(s) 52, 238
BmeRI GACNNNNNGTC 1 cut(s) 114
BmrFI CCNGG 2 cut(s) 52, 238
BmsI GCATC 2 cut(s) 38, 111
Bpu10I CCTNAGC 1 cut(s) 156
BsaAI YACGTR 1 cut(s) 202
BsaJI CCNNGG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 2 cut(s) 174, 237
BseBI CCWGG 2 cut(s) 52, 238
BseDI CCNNGG 1 cut(s) 51
BseGI GGATG 2 cut(s) 61, 267
BseLI CCNNNNNNNGG 2 cut(s) 174, 237
BseMII CTCAG 2 cut(s) 147, 201
BslI CCNNNNNNNGG 2 cut(s) 174, 237
Bsp143I GATC 1 cut(s) 58
BspCNI CTCAG 2 cut(s) 148, 202
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 1 cut(s) 58
Bst2UI CCWGG 2 cut(s) 52, 238
Bst6I CTCTTC 1 cut(s) 251
BstBAI YACGTR 1 cut(s) 202
BstDEI CTNAG 3 cut(s) 156, 210, 249
BstF5I GGATG 2 cut(s) 61, 267
BstH2I RGCGCY 1 cut(s) 163
BstHHI GCGC 1 cut(s) 162
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstNI CCWGG 2 cut(s) 52, 238
BstNSI RCATGY 1 cut(s) 103
BstSCI CCNGG 2 cut(s) 50, 236
BtsCI GGATG 2 cut(s) 61, 267
BtsIMutI CAGTG 1 cut(s) 207
CfoI GCGC 1 cut(s) 162
CseI GACGC 1 cut(s) 29
Csp6I GTAC 1 cut(s) 203
CviAII CATG 1 cut(s) 100
CviJI RGCY 1 cut(s) 70
CviKI_1 RGCY 1 cut(s) 70
CviQI GTAC 1 cut(s) 203
DdeI CTNAG 3 cut(s) 156, 210, 249
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
DriI GACNNNNNGTC 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 251
Eam1105I GACNNNNNGTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 251
Eco57I CTGAAG 1 cut(s) 65
EcoRII CCWGG 2 cut(s) 50, 236
FaeI CATG 1 cut(s) 103
FaiI YATR 2 cut(s) 73, 101
FatI CATG 1 cut(s) 99
FokI GGATG 2 cut(s) 68, 274
GlaI GCGC 1 cut(s) 161
HaeII RGCGCY 1 cut(s) 163
HgaI GACGC 1 cut(s) 29
HhaI GCGC 1 cut(s) 162
Hin1II CATG 1 cut(s) 103
Hin6I GCGC 1 cut(s) 160
HinP1I GCGC 1 cut(s) 160
HinfI GANTC 3 cut(s) 109, 136, 233
Hpy188I TCNGA 3 cut(s) 34, 45, 120
Hpy188III TCNNGA 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 19, 173
HpyCH4IV ACGT 2 cut(s) 115, 201
HpyF3I CTNAG 3 cut(s) 156, 210, 249
HpySE526I ACGT 2 cut(s) 115, 201
Hsp92II CATG 1 cut(s) 103
HspAI GCGC 1 cut(s) 160
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 6 cut(s) 37, 64, 95, 168, 223, 250
LweI GCATC 2 cut(s) 38, 111
MaeII ACGT 2 cut(s) 115, 201
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 3 cut(s) 131, 236, 268
MfeI CAATTG 1 cut(s) 219
MluCI AATT 1 cut(s) 219
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 3 cut(s) 168, 234, 252
MseI TTAA 1 cut(s) 87
MslI CAYNNNNRTG 1 cut(s) 104
MspR9I CCNGG 2 cut(s) 52, 238
MunI CAATTG 1 cut(s) 219
MvaI CCWGG 2 cut(s) 52, 238
NdeII GATC 1 cut(s) 58
NlaIII CATG 1 cut(s) 103
NspI RCATGY 1 cut(s) 103
PfeI GAWTC 2 cut(s) 136, 233
PfoI TCCNGGA 1 cut(s) 236
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
Ppu21I YACGTR 1 cut(s) 202
Psp6I CCWGG 2 cut(s) 50, 236
PspGI CCWGG 2 cut(s) 50, 236
RsaI GTAC 1 cut(s) 204
RsaNI GTAC 1 cut(s) 203
RseI CAYNNNNRTG 1 cut(s) 104
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 58
SchI GAGTC 1 cut(s) 103
ScrFI CCNGG 2 cut(s) 52, 238
SetI ASST 4 cut(s) 72, 118, 204, 245
SfaNI GCATC 2 cut(s) 38, 111
SmiMI CAYNNNNRTG 1 cut(s) 104
Sse9I AATT 1 cut(s) 219
StyD4I CCNGG 2 cut(s) 50, 236
TaiI ACGT 2 cut(s) 118, 204
TaqI TCGA 1 cut(s) 16
TasI AATT 1 cut(s) 219
TfiI GAWTC 2 cut(s) 136, 233
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 1 cut(s) 269
TspRI CASTG 1 cut(s) 214
XceI RCATGY 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.