Rh6AG067700

39S ribosomal protein L47

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
9865447 .. 9866518
1072 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG067700.1

Sequence Viewer

Length: 177 bp
ATGGCTTGGATGATGGCTCACCCGCTTGAGGAGTTCTTTGAAGCAGATAGGAAGACTGATGACGAAATGCCATGGTTGTATATGGTGGAAGTTGGAACTTGGAAGGCATTTGAAGATTCTGAACTGCATCTGAAGTCTTGGGATAATCTCAATAAGCTAGGGTTTTTTTCTGCTTAA

Protein Analysis

58

Amino Acids

6.97

Weight (kDa)

4.45

Isoelectric Point (pI)

40.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AcuI CTGAAG 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 2 cut(s) 41, 113
AluBI AGCT 1 cut(s) 157
AluI AGCT 1 cut(s) 157
AsuHPI GGTGA 1 cut(s) 11
BbsI GAAGAC 1 cut(s) 59
BccI CCATC 1 cut(s) 7
BfaI CTAG 1 cut(s) 158
BmsI GCATC 1 cut(s) 136
BpiI GAAGAC 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 28
BseRI GAGGAG 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 28
Bsp19I CCATGG 1 cut(s) 71
BspACI CCGC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 71
BssT1I CCWWGG 1 cut(s) 71
BstDSI CCRYGG 1 cut(s) 71
BstF5I GGATG 1 cut(s) 15
BstV2I GAAGAC 1 cut(s) 59
BtgI CCRYGG 1 cut(s) 71
BtsCI GGATG 1 cut(s) 15
CviAII CATG 1 cut(s) 72
CviJI RGCY 3 cut(s) 5, 17, 157
CviKI_1 RGCY 3 cut(s) 5, 17, 157
Eco130I CCWWGG 1 cut(s) 71
Eco57I CTGAAG 1 cut(s) 152
EcoT14I CCWWGG 1 cut(s) 71
ErhI CCWWGG 1 cut(s) 71
FaeI CATG 1 cut(s) 75
FaiI YATR 3 cut(s) 73, 81, 83
FatI CATG 1 cut(s) 71
FauI CCCGC 1 cut(s) 30
FokI GGATG 1 cut(s) 22
FspBI CTAG 1 cut(s) 158
Hin1II CATG 1 cut(s) 75
HinfI GANTC 1 cut(s) 116
HphI GGTGA 1 cut(s) 11
Hpy188I TCNGA 2 cut(s) 121, 132
HpyAV CCTTC 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 127
Hsp92II CATG 1 cut(s) 75
LweI GCATC 1 cut(s) 136
MaeI CTAG 1 cut(s) 158
MboII GAAGA 2 cut(s) 64, 125
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 1 cut(s) 22
MseI TTAA 1 cut(s) 175
NcoI CCATGG 1 cut(s) 71
NlaIII CATG 1 cut(s) 75
PfeI GAWTC 1 cut(s) 116
SaqAI TTAA 1 cut(s) 175
SetI ASST 1 cut(s) 159
SfaNI GCATC 1 cut(s) 136
SgeI CNNG 7 cut(s) 18, 34, 38, 84, 111, 150, 170
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
SsiI CCGC 1 cut(s) 23
SspMI CTAG 1 cut(s) 158
StyI CCWWGG 1 cut(s) 71
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 175
Tru9I TTAA 1 cut(s) 175
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.