RchiOBHm_Chr2g0130991

39S ribosomal protein L47

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
47067342 .. 47068469
1128 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50237

Sequence Viewer

Length: 207 bp
ATGATGATGGTGTCAAGGTATTTCAGGCGAACATTGTTTGCTACAGCCAAATCAGAACCTTCTGGTGCTGCTTCTATGGCTAAGATGACGGCTCACAACCCACTTGAGGAATTCTTTGAAGCAGGTAGGAAGCCTGATAAAGAAAAGCCAGTTGTATATGGTCTAAGTTGGAAGACATCAAAAACTGCGTCTAAAGTCTTGGGATGA

Protein Analysis

68

Amino Acids

7.59

Weight (kDa)

9.99

Isoelectric Point (pI)

33.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 113
AcsI RAATTY 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 1 cut(s) 119
ApeKI GCWGC 1 cut(s) 68
ApoI RAATTY 1 cut(s) 110
ArsI GACNNNNNNTTYG 2 cut(s) 173, 205
BbsI GAAGAC 1 cut(s) 179
BbvI GCAGC 1 cut(s) 55
BceAI ACGGC 1 cut(s) 105
BfmI CTRYAG 1 cut(s) 42
BfuAI ACCTGC 1 cut(s) 113
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
BpiI GAAGAC 1 cut(s) 179
BpuEI CTTGAG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse1I ACTGG 1 cut(s) 149
BseLI CCNNNNNNNGG 1 cut(s) 106
BseNI ACTGG 1 cut(s) 149
BseXI GCAGC 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 106
BspMI ACCTGC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 81, 164
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 179
BveI ACCTGC 1 cut(s) 113
CseI GACGC 1 cut(s) 177
CviJI RGCY 5 cut(s) 47, 80, 92, 133, 148
CviKI_1 RGCY 5 cut(s) 47, 80, 92, 133, 148
DdeI CTNAG 2 cut(s) 81, 164
EcoRI GAATTC 1 cut(s) 110
FaiI YATR 3 cut(s) 77, 157, 159
Fnu4HI GCNGC 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 69
GluI GCNGC 1 cut(s) 69
HgaI GACGC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 55
HpyAV CCTTC 1 cut(s) 69
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 2 cut(s) 81, 164
LpnPI CCDG 5 cut(s) 10, 48, 108, 147, 162
Lsp1109I GCAGC 1 cut(s) 55
MboII GAAGA 1 cut(s) 184
MluCI AATT 1 cut(s) 110
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 1 cut(s) 100
MwoI GCNNNNNNNGC 1 cut(s) 77
PkrI GCNGC 1 cut(s) 70
SatI GCNGC 1 cut(s) 69
SetI ASST 3 cut(s) 20, 61, 127
SfcI CTRYAG 1 cut(s) 42
SgeI CNNG 7 cut(s) 27, 37, 75, 116, 135, 146, 161
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 1 cut(s) 110
TasI AATT 1 cut(s) 110
TseI GCWGC 1 cut(s) 68
XapI RAATTY 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.