RchiOBHm_Chr3g0495991

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
46464859 .. 46465127
269 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 132 bp
ATGGGACTTGCTGTGGGTTCCAACTTTGTATGGCTTGTTCGAATTTTGATGATTATTTGCTACCCAATTGCTTATACAATTGGAAAGACATTGGATTCTATTCTGGGACATAATGAAGCATTATTTAGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

43

Amino Acids

4.81

Weight (kDa)

7.96

Isoelectric Point (pI)

25.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 42
ApoI RAATTY 1 cut(s) 42
AsuII TTCGAA 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 19
Bpu14I TTCGAA 1 cut(s) 40
BslFI GGGAC 2 cut(s) 18, 120
BsmFI GGGAC 2 cut(s) 18, 120
Bsp119I TTCGAA 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 19
BspT104I TTCGAA 1 cut(s) 40
BstBI TTCGAA 1 cut(s) 40
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
FaiI YATR 3 cut(s) 31, 75, 111
FaqI GGGAC 2 cut(s) 18, 120
FspEI CC 9 cut(s) 16, 34, 66, 77, 77, 78, 89, 90, 112
HinfI GANTC 1 cut(s) 95
LpnPI CCDG 1 cut(s) 89
MfeI CAATTG 2 cut(s) 66, 78
MluCI AATT 3 cut(s) 42, 66, 78
MmeI TCCRAC 1 cut(s) 45
MunI CAATTG 2 cut(s) 66, 78
NlaIV GGNNCC 1 cut(s) 19
NspV TTCGAA 1 cut(s) 40
PfeI GAWTC 1 cut(s) 95
PspN4I GGNNCC 1 cut(s) 19
PsrI GAACNNNNNNTAC 2 cut(s) 21, 53
SetI ASST 1 cut(s) 131
SfuI TTCGAA 1 cut(s) 40
SgeI CNNG 3 cut(s) 20, 47, 116
Sse9I AATT 3 cut(s) 42, 66, 78
TaqI TCGA 1 cut(s) 40
TasI AATT 3 cut(s) 42, 66, 78
TfiI GAWTC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 129
XapI RAATTY 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.