Rmu_sc0034900.1_g000001

DUF21 domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034900.1
OG0003036
Physical Location & Seq
Forward (+)
1 .. 1985
1985 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034900.1_g000001.1.cds

Sequence Viewer

Length: 195 bp
gttcttgatcttgtacttggacatggagatgatttgttcaggcgagcacagtcgaaagccctcgtctctgttcacgaccctgaggttggaaagggagttgaactaacacatgataaggcaatgattatcaatggagtgctagatttaactgaaaagatgcctaatgatttaaacaagtgttctatacttgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03022 ko05169 ko05203 map03022 map05169 map05203
Pfam Domains
Protein Families
DUF21

Protein Analysis

64

Amino Acids

7.01

Weight (kDa)

5.17

Isoelectric Point (pI)

40.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 101
Alw21I GWGCWC 1 cut(s) 49
Alw26I GTCTC 1 cut(s) 70
AxyI CCTNAGG 1 cut(s) 81
Bbv12I GWGCWC 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 140
BmsI GCATC 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 86
Bse21I CCTNAGG 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 86
BseMI GCAATG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 72
BsiHKAI GWGCWC 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 70
BsmBI CGTCTC 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 1 cut(s) 7
BspCNI CTCAG 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 126
BssMI GATC 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 1 cut(s) 7
Bsu36I CCTNAGG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 14
CviAII CATG 2 cut(s) 23, 110
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
CviQI GTAC 1 cut(s) 14
DdeI CTNAG 1 cut(s) 81
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
DraI TTTAAA 1 cut(s) 171
Eco81I CCTNAGG 1 cut(s) 81
Esp3I CGTCTC 1 cut(s) 70
FaeI CATG 2 cut(s) 26, 113
FaiI YATR 3 cut(s) 24, 111, 185
FatI CATG 2 cut(s) 22, 109
FspBI CTAG 1 cut(s) 140
Hin1II CATG 2 cut(s) 26, 113
Hpy166II GTNNAC 1 cut(s) 73
Hpy188III TCNNGA 2 cut(s) 5, 74
Hpy8I GTNNAC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 51
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 2 cut(s) 26, 113
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 2 cut(s) 25, 93
LweI GCATC 1 cut(s) 147
MaeI CTAG 1 cut(s) 140
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MhlI GDGCHC 1 cut(s) 49
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 2 cut(s) 71, 76
MseI TTAA 2 cut(s) 146, 170
MslI CAYNNNNRTG 1 cut(s) 27
NdeII GATC 1 cut(s) 7
NlaIII CATG 2 cut(s) 26, 113
RsaI GTAC 1 cut(s) 15
RsaNI GTAC 1 cut(s) 14
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 2 cut(s) 146, 170
Sau3AI GATC 1 cut(s) 7
SduI GDGCHC 1 cut(s) 49
SetI ASST 1 cut(s) 87
SfaNI GCATC 1 cut(s) 147
SmiMI CAYNNNNRTG 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
SspMI CTAG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 51
TaqI TCGA 1 cut(s) 53
TatI WGTACW 1 cut(s) 13
Tru1I TTAA 2 cut(s) 146, 170
Tru9I TTAA 2 cut(s) 146, 170
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.