Rh4DG073900

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
10967676 .. 10969058
1383 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG073900.1

Sequence Viewer

Length: 249 bp
ATGTATGGGCTTTCTGTTCTTGATCTTGTACTTGGACATGGAGATGATTTGTTTAGGCGAGCACAGTCGAAAGCCCTCGTCTCTATTCACGACCTTGAGGCTGGAAAGGGAGGTGAACTAACACATGACAACGATTACAGTGGAGCGCTAGATTTAACTGAAAAGACTGCCAAGGAGGCTATGACACCTATTGAATTAAGATTGTGCTTGGATGTTGATTCAAATTTAGACTGGGAAAAGACTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.03

Weight (kDa)

4.55

Isoelectric Point (pI)

34.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 247
AcsI RAATTY 1 cut(s) 223
AfaI GTAC 1 cut(s) 30
AfeI AGCGCT 1 cut(s) 147
AgsI TTSAA 2 cut(s) 194, 222
Alw21I GWGCWC 1 cut(s) 64
Alw26I GTCTC 1 cut(s) 85
Aor51HI AGCGCT 1 cut(s) 147
ApoI RAATTY 1 cut(s) 223
AspLEI GCGC 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 125
Bbv12I GWGCWC 1 cut(s) 64
BcoDI GTCTC 1 cut(s) 85
BfaI CTAG 1 cut(s) 149
BfoI RGCGCY 1 cut(s) 149
BglI GCCNNNNNGGC 1 cut(s) 176
BmrI ACTGGG 1 cut(s) 241
BmuI ACTGGG 1 cut(s) 241
BpuEI CTTGAG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 236
BseDI CCNNGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 217
BseNI ACTGG 1 cut(s) 236
BsiHKAI GWGCWC 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 85
BsmBI CGTCTC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 22
BsrI ACTGG 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 171
BssMI GATC 1 cut(s) 22
BssT1I CCWWGG 1 cut(s) 171
Bst4CI ACNGT 2 cut(s) 66, 140
BstC8I GCNNGC 1 cut(s) 60
BstF5I GGATG 1 cut(s) 217
BstH2I RGCGCY 1 cut(s) 149
BstHHI GCGC 1 cut(s) 148
BstKTI GATC 1 cut(s) 25
BstMAI GTCTC 1 cut(s) 85
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 217
BtsIMutI CAGTG 1 cut(s) 145
Cac8I GCNNGC 1 cut(s) 60
CfoI GCGC 1 cut(s) 148
Csp6I GTAC 1 cut(s) 29
CviAII CATG 2 cut(s) 38, 125
CviJI RGCY 4 cut(s) 10, 74, 101, 179
CviKI_1 RGCY 4 cut(s) 10, 74, 101, 179
CviQI GTAC 1 cut(s) 29
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco130I CCWWGG 1 cut(s) 171
Eco47III AGCGCT 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
Esp3I CGTCTC 1 cut(s) 85
FaeI CATG 2 cut(s) 41, 128
FaiI YATR 5 cut(s) 6, 39, 126, 182, 247
FatI CATG 2 cut(s) 37, 124
FokI GGATG 1 cut(s) 224
FspBI CTAG 1 cut(s) 149
GlaI GCGC 1 cut(s) 147
HaeII RGCGCY 1 cut(s) 149
HhaI GCGC 1 cut(s) 148
Hin1II CATG 2 cut(s) 41, 128
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HinfI GANTC 1 cut(s) 218
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 116
Hpy188III TCNNGA 2 cut(s) 20, 89
Hpy8I GTNNAC 1 cut(s) 116
HpyCH4III ACNGT 2 cut(s) 66, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
Hsp92II CATG 2 cut(s) 41, 128
HspAI GCGC 1 cut(s) 146
Kzo9I GATC 1 cut(s) 22
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 2 cut(s) 87, 217
MaeI CTAG 1 cut(s) 149
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 2 cut(s) 194, 223
MnlI CCTC 4 cut(s) 86, 91, 104, 169
MseI TTAA 2 cut(s) 155, 197
MslI CAYNNNNRTG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 176
NdeII GATC 1 cut(s) 22
NlaIII CATG 2 cut(s) 41, 128
PfeI GAWTC 1 cut(s) 218
PsiI TTATAA 1 cut(s) 247
RsaI GTAC 1 cut(s) 30
RsaNI GTAC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 2 cut(s) 155, 197
Sau3AI GATC 1 cut(s) 22
SduI GDGCHC 1 cut(s) 64
SetI ASST 3 cut(s) 96, 115, 190
SmiMI CAYNNNNRTG 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
Sse9I AATT 2 cut(s) 194, 223
SspMI CTAG 1 cut(s) 149
StyI CCWWGG 1 cut(s) 171
TaaI ACNGT 2 cut(s) 66, 140
TaqI TCGA 1 cut(s) 68
TasI AATT 2 cut(s) 194, 223
TatI WGTACW 1 cut(s) 28
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 2 cut(s) 155, 197
Tru9I TTAA 2 cut(s) 155, 197
TscAI CASTG 1 cut(s) 145
TspRI CASTG 1 cut(s) 145
XapI RAATTY 1 cut(s) 223
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.