Rh6AG091300

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
13554546 .. 13558756
4211 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG091300.1

Sequence Viewer

Length: 180 bp
ATGCTCAAGATATGGGCTTTCTGTTGGCTTGTTCGCATTCTGATGATCATCTGCTATCCAATCTCCTACCCAATTGGAAAAGTTCTTGATCTTGTACTTGGACATGGAGATGATTTGTTCAGGCGAGCACAGTCGAAAGCCCTCGTCTTTGTTCACGACCCTGAGGGCATGGTGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.8

Weight (kDa)

7.83

Isoelectric Point (pI)

33.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 96
Alw21I GWGCWC 1 cut(s) 130
AxyI CCTNAGG 1 cut(s) 162
Bbv12I GWGCWC 1 cut(s) 130
BclI TGATCA 1 cut(s) 45
BsaBI GATNNNNATC 1 cut(s) 47
Bse21I CCTNAGG 1 cut(s) 162
Bse8I GATNNNNATC 1 cut(s) 47
BseJI GATNNNNATC 1 cut(s) 47
BseMII CTCAG 1 cut(s) 153
BsiHKAI GWGCWC 1 cut(s) 130
BsmI GAATGC 1 cut(s) 36
Bsp1286I GDGCHC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 45, 88
BspCNI CTCAG 1 cut(s) 154
BssMI GATC 2 cut(s) 45, 88
Bst4CI ACNGT 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 162
BstKTI GATC 2 cut(s) 48, 91
BstMBI GATC 2 cut(s) 45, 88
Bsu36I CCTNAGG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 126
Csp6I GTAC 1 cut(s) 95
CviAII CATG 2 cut(s) 104, 169
CviJI RGCY 3 cut(s) 17, 28, 140
CviKI_1 RGCY 3 cut(s) 17, 28, 140
CviQI GTAC 1 cut(s) 95
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 47, 90
DpnII GATC 2 cut(s) 45, 88
Eco81I CCTNAGG 1 cut(s) 162
FaeI CATG 2 cut(s) 107, 172
FaiI YATR 3 cut(s) 13, 105, 170
FatI CATG 2 cut(s) 103, 168
FbaI TGATCA 1 cut(s) 45
Hin1II CATG 2 cut(s) 107, 172
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 3 cut(s) 7, 86, 155
Hpy8I GTNNAC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 2 cut(s) 107, 172
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 2 cut(s) 45, 88
LpnPI CCDG 2 cut(s) 106, 174
MalI GATC 2 cut(s) 47, 90
MboI GATC 2 cut(s) 45, 88
MfeI CAATTG 1 cut(s) 72
MhlI GDGCHC 1 cut(s) 130
MluCI AATT 2 cut(s) 72, 175
MnlI CCTC 2 cut(s) 152, 157
MslI CAYNNNNRTG 2 cut(s) 41, 108
MunI CAATTG 1 cut(s) 72
Mva1269I GAATGC 1 cut(s) 36
NdeII GATC 2 cut(s) 45, 88
NlaIII CATG 2 cut(s) 107, 172
PctI GAATGC 1 cut(s) 36
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
RseI CAYNNNNRTG 2 cut(s) 41, 108
Sau3AI GATC 2 cut(s) 45, 88
SduI GDGCHC 1 cut(s) 130
SmiMI CAYNNNNRTG 2 cut(s) 41, 108
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 2 cut(s) 72, 175
TaaI ACNGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 134
TasI AATT 2 cut(s) 72, 175
TatI WGTACW 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.