RchiOBHm_Chr2g0114521

CYSTM1 family protein A-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
26450610 .. 26451148
539 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGAGTTCAAGCACTAAATCTTCCGCTGTAGCATACCCTCCATTGCCTTATTCGACTGCACCGGGTCCTTACAATGTTCAGGCTCCACCACCTGCCGGTTATCCCACAAGATCAGATGTCGGTGACCAAAACCCTGCTCGTGTTCCAGTAGAAACCAAGTCGAAGGGTGATGGGTTCTGGAAGGGATGCTGTGCTGCTCTATGTTGCTGCTGCATGTTGGATGCTTGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.02

Weight (kDa)

7.5

Isoelectric Point (pI)

62.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CYSTM PF12734 33 - 77 3.3e-12 Cysteine-rich TM module stress tolerance
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 100
Acc36I ACCTGC 1 cut(s) 100
AciI CCGC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 95
AgsI TTSAA 1 cut(s) 9
ApeKI GCWGC 3 cut(s) 194, 207, 210
AspS9I GGNCC 1 cut(s) 65
AsuC2I CCSGG 1 cut(s) 63
AsuHPI GGTGA 2 cut(s) 134, 179
AvaII GGWCC 1 cut(s) 65
BauI CACGAG 1 cut(s) 138
BbvI GCAGC 3 cut(s) 181, 194, 197
BccI CCATC 1 cut(s) 164
BcnI CCSGG 1 cut(s) 63
BfmI CTRYAG 1 cut(s) 27
BfuAI ACCTGC 1 cut(s) 100
BisI GCNGC 3 cut(s) 195, 208, 211
BlsI GCNGC 3 cut(s) 196, 209, 212
Bme1390I CCNGG 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 65
BmiI GGNNCC 2 cut(s) 66, 84
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 2 cut(s) 176, 211
BpuMI CCSGG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse118I RCCGGY 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 146
Bse3DI GCAATG 1 cut(s) 41
BseGI GGATG 2 cut(s) 191, 226
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMI GCAATG 1 cut(s) 41
BseNI ACTGG 1 cut(s) 146
BseXI GCAGC 3 cut(s) 181, 194, 197
BsgI GTGCAG 1 cut(s) 42
BsiSI CCGG 2 cut(s) 62, 96
BslI CCNNNNNNNGG 1 cut(s) 95
Bsp143I GATC 1 cut(s) 110
BspACI CCGC 1 cut(s) 24
BspLI GGNNCC 2 cut(s) 66, 84
BspMI ACCTGC 1 cut(s) 100
BsrDI GCAATG 1 cut(s) 41
BsrFI RCCGGY 1 cut(s) 95
BsrI ACTGG 1 cut(s) 146
BssAI RCCGGY 1 cut(s) 95
BssMI GATC 1 cut(s) 110
BssSI CACGAG 1 cut(s) 138
Bst2BI CACGAG 1 cut(s) 138
BstEII GGTNACC 1 cut(s) 122
BstF5I GGATG 2 cut(s) 191, 226
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 217
BstPI GGTNACC 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 27
BstV1I GCAGC 3 cut(s) 181, 194, 197
BtsCI GGATG 2 cut(s) 191, 226
BveI ACCTGC 1 cut(s) 100
Cfr10I RCCGGY 1 cut(s) 95
Cfr13I GGNCC 1 cut(s) 65
CviAII CATG 1 cut(s) 214
CviJI RGCY 1 cut(s) 83
CviKI_1 RGCY 1 cut(s) 83
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 65
Eco91I GGTNACC 1 cut(s) 122
EcoO109I RGGNCCY 1 cut(s) 65
EcoO65I GGTNACC 1 cut(s) 122
FaeI CATG 1 cut(s) 217
FaiI YATR 3 cut(s) 34, 202, 215
FatI CATG 1 cut(s) 213
Fnu4HI GCNGC 3 cut(s) 195, 208, 211
FokI GGATG 1 cut(s) 198
Fsp4HI GCNGC 3 cut(s) 195, 208, 211
GluI GCNGC 3 cut(s) 195, 208, 211
HapII CCGG 2 cut(s) 62, 96
Hin1II CATG 1 cut(s) 217
HpaII CCGG 2 cut(s) 62, 96
HphI GGTGA 2 cut(s) 134, 179
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 1 cut(s) 178
HpyAV CCTTC 2 cut(s) 157, 175
HpyCH4V TGCA 2 cut(s) 59, 213
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 7 cut(s) 65, 75, 105, 109, 147, 159, 163
Lsp1109I GCAGC 3 cut(s) 181, 194, 197
LweI GCATC 2 cut(s) 176, 211
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 1 cut(s) 12
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 1 cut(s) 48
MspA1I CMGCKG 1 cut(s) 26
MspI CCGG 2 cut(s) 62, 96
MspR9I CCNGG 1 cut(s) 63
NciI CCSGG 1 cut(s) 63
NdeII GATC 1 cut(s) 110
NlaIII CATG 1 cut(s) 217
NlaIV GGNNCC 2 cut(s) 66, 84
NmuCI GTSAC 1 cut(s) 122
NspI RCATGY 1 cut(s) 217
PaqCI CACCTGC 1 cut(s) 100
PkrI GCNGC 3 cut(s) 196, 209, 212
PpuMI RGGWCCY 1 cut(s) 65
Psp5II RGGWCCY 1 cut(s) 65
PspEI GGTNACC 1 cut(s) 122
PspN4I GGNNCC 2 cut(s) 66, 84
PspPI GGNCC 1 cut(s) 65
PspPPI RGGWCCY 1 cut(s) 65
SatI GCNGC 3 cut(s) 195, 208, 211
Sau3AI GATC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 65
ScrFI CCNGG 1 cut(s) 63
SetI ASST 1 cut(s) 94
SfaNI GCATC 2 cut(s) 176, 211
SfcI CTRYAG 1 cut(s) 27
SinI GGWCC 1 cut(s) 65
SsiI CCGC 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 61
TaqI TCGA 2 cut(s) 53, 161
TseFI GTSAC 1 cut(s) 122
TseI GCWGC 3 cut(s) 194, 207, 210
Tsp45I GTSAC 1 cut(s) 122
VpaK11BI GGWCC 1 cut(s) 65
XceI RCATGY 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.