RchiOBHm_Chr1g0324481

ATP-dependent zinc metalloprotease FTSH

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
12237450 .. 12238415
966 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGTATATCACTGGTGATTTTTCCATTGAGGCTCCTTGTTTTGTATTTGTGGACGAGATTGATGCTATTGCTAGAAGGGATGCAAGACATGATCCTAGAAGAAGAGCAACATTTGAGGCTTTGATTGCACAGCTCGATGGGGAGAAGGAAAAAACTAGTGTTGATCGCTTCTCTCTCAGACAAGCTGTCATATTCATCTATGCTACCAACATGCCAGATGAATTAGACCTTGAATTTGTTTGA

Protein Analysis

80

Amino Acids

9.26

Weight (kDa)

4.59

Isoelectric Point (pI)

49.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AAA PF00004 10 - 77 2.8e-11 ATPase family associated with various cellular activities (AAA)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 86
AcsI RAATTY 1 cut(s) 233
AgsI TTSAA 1 cut(s) 233
AhdI GACNNNNNGTC 1 cut(s) 185
AhlI ACTAGT 1 cut(s) 155
AluBI AGCT 2 cut(s) 133, 185
AluI AGCT 2 cut(s) 133, 185
AlwI GGATC 1 cut(s) 86
ApoI RAATTY 1 cut(s) 233
ArsI GACNNNNNNTTYG 1 cut(s) 218
AsuHPI GGTGA 1 cut(s) 26
BccI CCATC 1 cut(s) 131
BcgI CGANNNNNNTGC 2 cut(s) 44, 78
BcuI ACTAGT 1 cut(s) 155
BfaI CTAG 3 cut(s) 72, 96, 156
BmeRI GACNNNNNGTC 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 33
BmsI GCATC 2 cut(s) 52, 70
Bse1I ACTGG 1 cut(s) 16
BseGI GGATG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 190
BseNI ACTGG 1 cut(s) 16
Bsp143I GATC 2 cut(s) 91, 163
BspCNI CTCAG 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 33
BspPI GGATC 1 cut(s) 86
BspQI GCTCTTC 1 cut(s) 97
BsrI ACTGG 1 cut(s) 16
BssMI GATC 2 cut(s) 91, 163
Bst6I CTCTTC 1 cut(s) 97
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 2 cut(s) 94, 166
BstMBI GATC 2 cut(s) 91, 163
BstMWI GCNNNNNNNGC 1 cut(s) 125
BstNSI RCATGY 1 cut(s) 214
BtsCI GGATG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 9
CviAII CATG 2 cut(s) 89, 211
CviJI RGCY 4 cut(s) 32, 119, 133, 185
CviKI_1 RGCY 4 cut(s) 32, 119, 133, 185
DdeI CTNAG 1 cut(s) 176
DpnI GATC 2 cut(s) 93, 165
DpnII GATC 2 cut(s) 91, 163
DriI GACNNNNNGTC 1 cut(s) 185
Eam1104I CTCTTC 1 cut(s) 97
Eam1105I GACNNNNNGTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 97
FaeI CATG 2 cut(s) 92, 214
FaiI YATR 5 cut(s) 6, 90, 191, 201, 212
FatI CATG 2 cut(s) 88, 210
FokI GGATG 1 cut(s) 92
FspBI CTAG 3 cut(s) 72, 96, 156
Hin1II CATG 2 cut(s) 92, 214
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 69, 139
HpyCH4V TGCA 2 cut(s) 83, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 176
Hsp92II CATG 2 cut(s) 92, 214
Kzo9I GATC 2 cut(s) 91, 163
LguI GCTCTTC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 228
LweI GCATC 2 cut(s) 52, 70
MaeI CTAG 3 cut(s) 72, 96, 156
MalI GATC 2 cut(s) 93, 165
MboI GATC 2 cut(s) 91, 163
MboII GAAGA 2 cut(s) 111, 114
MluCI AATT 2 cut(s) 221, 233
MnlI CCTC 2 cut(s) 22, 109
MwoI GCNNNNNNNGC 1 cut(s) 125
NdeII GATC 2 cut(s) 91, 163
NlaIII CATG 2 cut(s) 92, 214
NlaIV GGNNCC 1 cut(s) 33
NspI RCATGY 1 cut(s) 214
PciSI GCTCTTC 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 33
SapI GCTCTTC 1 cut(s) 97
Sau3AI GATC 2 cut(s) 91, 163
SetI ASST 3 cut(s) 135, 187, 231
SfaNI GCATC 2 cut(s) 52, 70
SpeI ACTAGT 1 cut(s) 155
Sse9I AATT 2 cut(s) 221, 233
SspMI CTAG 3 cut(s) 72, 96, 156
TaqI TCGA 1 cut(s) 135
TasI AATT 2 cut(s) 221, 233
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 184, 234
TspRI CASTG 1 cut(s) 16
XapI RAATTY 1 cut(s) 233
XceI RCATGY 1 cut(s) 214
XspI CTAG 3 cut(s) 72, 96, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.