RchiOBHm_Chr1g0336241

DUF21 domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
27904795 .. 27906952
2158 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 297 bp
ATGATCATCTGCTATCCAATCGCCTACCCAATTGGAAAAGTTCTTGATCTTGTACTTGGACATGGAGAAGATTTGTTCAGGCGAGCACAGTTGAAAGCCCTCGCCTCTATTCACAACCTTGAGGCTGGAAGGGGAGGTGAACTAACACATGATAAGACAACGATTATCAGTGGAGCGCTAGATTTAACTGAAAAGACTGCCAAGGAGGCTATGACACCTATTGAATCAAGATTGTGCTTGGATGTTGATTCAAAGTTAGACTGTTTTCTTCCTTCCACTAATAAGGACATTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.68

Weight (kDa)

5.5

Isoelectric Point (pI)

33.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 54
AfeI AGCGCT 1 cut(s) 177
AgsI TTSAA 3 cut(s) 94, 224, 252
Alw21I GWGCWC 1 cut(s) 88
Aor51HI AGCGCT 1 cut(s) 177
AspLEI GCGC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 88
BclI TGATCA 1 cut(s) 3
BfaI CTAG 1 cut(s) 179
BfoI RGCGCY 1 cut(s) 179
BglI GCCNNNNNGGC 1 cut(s) 206
BpuEI CTTGAG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 201
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 247
BsiHKAI GWGCWC 1 cut(s) 88
Bsp1286I GDGCHC 1 cut(s) 88
Bsp143I GATC 2 cut(s) 3, 46
BssECI CCNNGG 1 cut(s) 201
BssMI GATC 2 cut(s) 3, 46
BssT1I CCWWGG 1 cut(s) 201
Bst4CI ACNGT 2 cut(s) 90, 263
BstC8I GCNNGC 1 cut(s) 84
BstF5I GGATG 1 cut(s) 247
BstH2I RGCGCY 1 cut(s) 179
BstHHI GCGC 1 cut(s) 178
BstKTI GATC 2 cut(s) 6, 49
BstMBI GATC 2 cut(s) 3, 46
BstMWI GCNNNNNNNGC 1 cut(s) 206
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 175
Cac8I GCNNGC 1 cut(s) 84
CfoI GCGC 1 cut(s) 178
Csp6I GTAC 1 cut(s) 53
CviAII CATG 2 cut(s) 62, 149
CviJI RGCY 3 cut(s) 98, 125, 209
CviKI_1 RGCY 3 cut(s) 98, 125, 209
CviQI GTAC 1 cut(s) 53
DpnI GATC 2 cut(s) 5, 48
DpnII GATC 2 cut(s) 3, 46
Eco130I CCWWGG 1 cut(s) 201
Eco47III AGCGCT 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 201
ErhI CCWWGG 1 cut(s) 201
FaeI CATG 2 cut(s) 65, 152
FaiI YATR 3 cut(s) 63, 150, 212
FatI CATG 2 cut(s) 61, 148
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 254
FspBI CTAG 1 cut(s) 179
GlaI GCGC 1 cut(s) 177
HaeII RGCGCY 1 cut(s) 179
HhaI GCGC 1 cut(s) 178
Hin1II CATG 2 cut(s) 65, 152
Hin6I GCGC 1 cut(s) 176
HinP1I GCGC 1 cut(s) 176
HinfI GANTC 2 cut(s) 224, 248
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 140
Hpy188III TCNNGA 3 cut(s) 44, 228, 294
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 2 cut(s) 123, 282
HpyCH4III ACNGT 2 cut(s) 90, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 206
Hsp92II CATG 2 cut(s) 65, 152
HspAI GCGC 1 cut(s) 176
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 46
LmnI GCTCC 1 cut(s) 173
LpnPI CCDG 2 cut(s) 64, 111
MaeI CTAG 1 cut(s) 179
MalI GATC 2 cut(s) 5, 48
MboI GATC 2 cut(s) 3, 46
MboII GAAGA 2 cut(s) 80, 260
MfeI CAATTG 1 cut(s) 30
MhlI GDGCHC 1 cut(s) 88
MluCI AATT 1 cut(s) 30
MnlI CCTC 5 cut(s) 110, 115, 115, 128, 199
MseI TTAA 1 cut(s) 185
MunI CAATTG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 206
NdeII GATC 2 cut(s) 3, 46
NlaIII CATG 2 cut(s) 65, 152
PfeI GAWTC 2 cut(s) 224, 248
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SaqAI TTAA 1 cut(s) 185
Sau3AI GATC 2 cut(s) 3, 46
SduI GDGCHC 1 cut(s) 88
SetI ASST 3 cut(s) 120, 139, 220
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 1 cut(s) 30
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 1 cut(s) 201
TaaI ACNGT 2 cut(s) 90, 263
TasI AATT 1 cut(s) 30
TatI WGTACW 1 cut(s) 52
TfiI GAWTC 2 cut(s) 224, 248
Tru1I TTAA 1 cut(s) 185
Tru9I TTAA 1 cut(s) 185
TscAI CASTG 1 cut(s) 175
TspRI CASTG 1 cut(s) 175
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.