RchiOBHm_Chr1g0379241

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
65347305 .. 65349803
2499 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGTCCTCAAGGTATCCAGGGTCTCCTTCCTTGCTTAGTCCCGTGACAGAGGAAGACGAAGAACCTGTTCATATTGATGAAACTAGTGCAGATGACCATGACGACATAATGCAGTGGAGTGAGCAAGATAATGATATGAGCAGTGAGGAATTTAGGGAAGTCATTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.44

Weight (kDa)

4.05

Isoelectric Point (pI)

115.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 149
AgsI TTSAA 1 cut(s) 167
AhlI ACTAGT 1 cut(s) 83
AjnI CCWGG 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 27
ApoI RAATTY 1 cut(s) 149
Asp700I GAANNNNTTC 1 cut(s) 66
BbsI GAAGAC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 27
BcuI ACTAGT 1 cut(s) 83
BfaI CTAG 1 cut(s) 84
BfuI GTATCC 1 cut(s) 24
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BpiI GAAGAC 1 cut(s) 60
BsaI GGTCTC 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 17
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 17
BsgI GTGCAG 1 cut(s) 108
BslFI GGGAC 1 cut(s) 24
BsmAI GTCTC 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 24
Bso31I GGTCTC 1 cut(s) 27
BspTNI GGTCTC 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 27
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 60
BsuI GTATCC 1 cut(s) 24
BtsI GCAGTG 2 cut(s) 119, 148
BtsIMutI CAGTG 2 cut(s) 119, 148
CviAII CATG 1 cut(s) 98
DdeI CTNAG 1 cut(s) 35
Eco31I GGTCTC 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 16
FaeI CATG 1 cut(s) 101
FaiI YATR 4 cut(s) 72, 99, 107, 137
FaqI GGGAC 1 cut(s) 24
FatI CATG 1 cut(s) 97
FspBI CTAG 1 cut(s) 84
Hin1II CATG 1 cut(s) 101
HpyAV CCTTC 1 cut(s) 36
HpyCH4V TGCA 2 cut(s) 89, 112
HpyF3I CTNAG 1 cut(s) 35
Hsp92II CATG 1 cut(s) 101
LpnPI CCDG 3 cut(s) 3, 30, 78
MaeI CTAG 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 43
MboII GAAGA 2 cut(s) 65, 71
MluCI AATT 1 cut(s) 149
MnlI CCTC 3 cut(s) 16, 43, 139
MroXI GAANNNNTTC 1 cut(s) 66
MslI CAYNNNNRTG 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NlaIII CATG 1 cut(s) 101
NmuCI GTSAC 1 cut(s) 43
PdmI GAANNNNTTC 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 18
SetI ASST 2 cut(s) 14, 67
SmiMI CAYNNNNRTG 1 cut(s) 75
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
SpeI ACTAGT 1 cut(s) 83
Sse9I AATT 1 cut(s) 149
SspMI CTAG 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 16
TasI AATT 1 cut(s) 149
TscAI CASTG 2 cut(s) 119, 148
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 2 cut(s) 59, 93
TspRI CASTG 2 cut(s) 119, 148
XapI RAATTY 1 cut(s) 149
XmnI GAANNNNTTC 1 cut(s) 66
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.