Rh5DG324000

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
42302856 .. 42304387
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG324000.1

Sequence Viewer

Length: 234 bp
ATGCCTGTGAACCCCAGTAGCCAAGAAACCCTGGGTCATTGTTTCATAGAGTTTAATTCTCCTCAGTCCTCAAGGTATCCAGGGTCTCCTTCCTTGCTTAGTCCCGTAACAGAGGAAGACGAAGAACCCGTTCATAGTGATGAAACTATTGCAGATGACCATGACGACATAATGCAGTGGAGTGAGCAAGACAATGATATGAGCAGTGAGGAATTTAGGGAAGTCATTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.76

Weight (kDa)

4.05

Isoelectric Point (pI)

112.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 212
AgsI TTSAA 1 cut(s) 230
AjnI CCWGG 2 cut(s) 30, 79
Alw26I GTCTC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 212
Asp700I GAANNNNTTC 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 123
BciT130I CCWGG 2 cut(s) 32, 81
BciVI GTATCC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 90
BfuI GTATCC 1 cut(s) 87
Bme1390I CCNGG 2 cut(s) 32, 81
BmrFI CCNGG 2 cut(s) 32, 81
BmrI ACTGGG 1 cut(s) 9
BmuI ACTGGG 1 cut(s) 9
BpiI GAAGAC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 55
BsaI GGTCTC 1 cut(s) 90
BsaJI CCNNGG 3 cut(s) 30, 31, 80
Bse1I ACTGG 1 cut(s) 15
BseBI CCWGG 2 cut(s) 32, 81
BseDI CCNNGG 3 cut(s) 30, 31, 80
BseMII CTCAG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 51
BslFI GGGAC 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 87
Bso31I GGTCTC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 76
BspTNI GGTCTC 1 cut(s) 90
BsrI ACTGG 1 cut(s) 15
BssECI CCNNGG 3 cut(s) 30, 31, 80
Bst2UI CCWGG 2 cut(s) 32, 81
BstDEI CTNAG 2 cut(s) 63, 98
BstMAI GTCTC 1 cut(s) 90
BstNI CCWGG 2 cut(s) 32, 81
BstSCI CCNGG 2 cut(s) 30, 79
BstV2I GAAGAC 1 cut(s) 123
BsuI GTATCC 1 cut(s) 87
BtsI GCAGTG 2 cut(s) 182, 211
BtsIMutI CAGTG 2 cut(s) 182, 211
CviAII CATG 1 cut(s) 161
CviJI RGCY 1 cut(s) 21
CviKI_1 RGCY 1 cut(s) 21
DdeI CTNAG 2 cut(s) 63, 98
Eco31I GGTCTC 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 30, 79
FaeI CATG 1 cut(s) 164
FaiI YATR 5 cut(s) 47, 135, 162, 170, 200
FaqI GGGAC 1 cut(s) 87
FatI CATG 1 cut(s) 160
Hin1II CATG 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 99
HpyCH4V TGCA 2 cut(s) 152, 175
HpyF3I CTNAG 2 cut(s) 63, 98
Hsp92II CATG 1 cut(s) 164
LpnPI CCDG 6 cut(s) 17, 18, 28, 44, 66, 93
MaeIII GTNAC 1 cut(s) 106
MboII GAAGA 2 cut(s) 128, 134
MluCI AATT 2 cut(s) 55, 212
MnlI CCTC 4 cut(s) 72, 79, 106, 202
MroXI GAANNNNTTC 1 cut(s) 129
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 1 cut(s) 138
MspR9I CCNGG 2 cut(s) 32, 81
MvaI CCWGG 2 cut(s) 32, 81
NlaIII CATG 1 cut(s) 164
PasI CCCWGGG 1 cut(s) 31
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PdmI GAANNNNTTC 1 cut(s) 129
Psp6I CCWGG 2 cut(s) 30, 79
PspGI CCWGG 2 cut(s) 30, 79
RseI CAYNNNNRTG 1 cut(s) 138
SaqAI TTAA 1 cut(s) 54
ScrFI CCNGG 2 cut(s) 32, 81
SetI ASST 1 cut(s) 77
SmiMI CAYNNNNRTG 1 cut(s) 138
SmlI CTYRAG 1 cut(s) 70
SmoI CTYRAG 1 cut(s) 70
Sse9I AATT 2 cut(s) 55, 212
StyD4I CCNGG 2 cut(s) 30, 79
TasI AATT 2 cut(s) 55, 212
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 2 cut(s) 182, 211
TspDTI ATGAA 3 cut(s) 34, 122, 156
TspRI CASTG 2 cut(s) 182, 211
XapI RAATTY 1 cut(s) 212
XmnI GAANNNNTTC 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.