Rmu_sc0040203.1_g000001

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040203.1
Physical Location & Seq
Forward (+)
1 .. 1076
1076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040203.1_g000001.1.cds

Sequence Viewer

Length: 240 bp
tcctcaaggtatccagggtctccttccttgcttagtcccgtaatagaggaagacgaagaacccgttcatagtgatgaaactagtgcagatgaccatgacgacataatgcagtggagtgagcaagaaatggatgatgatgtagaagaagaatatcatggtcatgatgcacaagaaatggaaacaataagaaataacattactcaaaatttgatgaatgcgcgtaataacgtgaacatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.1

Weight (kDa)

4.05

Isoelectric Point (pI)

82.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 220
AcsI RAATTY 1 cut(s) 205
AhlI ACTAGT 1 cut(s) 80
AjnI CCWGG 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 205
Asp700I GAANNNNTTC 1 cut(s) 63
AspLEI GCGC 1 cut(s) 220
BbsI GAAGAC 1 cut(s) 57
BciT130I CCWGG 1 cut(s) 15
BciVI GTATCC 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 24
BcuI ACTAGT 1 cut(s) 80
BfaI CTAG 1 cut(s) 81
BfuI GTATCC 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 24
BsaJI CCNNGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 14
BseGI GGATG 1 cut(s) 136
BsgI GTGCAG 1 cut(s) 105
Bsh1236I CGCG 1 cut(s) 220
BslFI GGGAC 1 cut(s) 21
BsmAI GTCTC 1 cut(s) 24
BsmFI GGGAC 1 cut(s) 21
BsmI GAATGC 1 cut(s) 220
Bso31I GGTCTC 1 cut(s) 24
BspFNI CGCG 1 cut(s) 220
BspHI TCATGA 1 cut(s) 160
BspTNI GGTCTC 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 136
BstFNI CGCG 1 cut(s) 220
BstHHI GCGC 1 cut(s) 220
BstMAI GTCTC 1 cut(s) 24
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstUI CGCG 1 cut(s) 220
BstV2I GAAGAC 1 cut(s) 57
BsuI GTATCC 1 cut(s) 21
BtsCI GGATG 1 cut(s) 136
BtsI GCAGTG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 116
CciI TCATGA 1 cut(s) 160
CfoI GCGC 1 cut(s) 220
CviAII CATG 3 cut(s) 95, 155, 161
DdeI CTNAG 1 cut(s) 32
Eco31I GGTCTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 3 cut(s) 98, 158, 164
FaiI YATR 5 cut(s) 69, 96, 104, 156, 162
FaqI GGGAC 1 cut(s) 21
FatI CATG 3 cut(s) 94, 154, 160
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 81
GlaI GCGC 1 cut(s) 219
HhaI GCGC 1 cut(s) 220
Hin1II CATG 3 cut(s) 98, 158, 164
Hin6I GCGC 1 cut(s) 218
HinP1I GCGC 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 232
Hpy188III TCNNGA 1 cut(s) 161
Hpy8I GTNNAC 1 cut(s) 232
HpyAV CCTTC 1 cut(s) 33
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 3 cut(s) 86, 109, 167
HpyF3I CTNAG 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 3 cut(s) 98, 158, 164
HspAI GCGC 1 cut(s) 218
LpnPI CCDG 1 cut(s) 27
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 228
MboII GAAGA 4 cut(s) 62, 68, 155, 158
MluCI AATT 1 cut(s) 205
MnlI CCTC 2 cut(s) 13, 40
MroXI GAANNNNTTC 1 cut(s) 63
MslI CAYNNNNRTG 2 cut(s) 72, 159
MspR9I CCNGG 1 cut(s) 15
Mva1269I GAATGC 1 cut(s) 220
MvaI CCWGG 1 cut(s) 15
MvnI CGCG 1 cut(s) 220
NlaIII CATG 3 cut(s) 98, 158, 164
PagI TCATGA 1 cut(s) 160
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PctI GAATGC 1 cut(s) 220
PdmI GAANNNNTTC 1 cut(s) 63
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
RseI CAYNNNNRTG 2 cut(s) 72, 159
ScrFI CCNGG 1 cut(s) 15
SetI ASST 2 cut(s) 11, 231
SfaNI GCATC 1 cut(s) 154
SmiMI CAYNNNNRTG 2 cut(s) 72, 159
SmlI CTYRAG 1 cut(s) 4
SmoI CTYRAG 1 cut(s) 4
SpeI ACTAGT 1 cut(s) 80
Sse9I AATT 1 cut(s) 205
SspMI CTAG 1 cut(s) 81
StyD4I CCNGG 1 cut(s) 13
TaiI ACGT 1 cut(s) 231
TasI AATT 1 cut(s) 205
TscAI CASTG 1 cut(s) 116
TspDTI ATGAA 3 cut(s) 56, 90, 227
TspRI CASTG 1 cut(s) 116
XapI RAATTY 1 cut(s) 205
XmnI GAANNNNTTC 1 cut(s) 63
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.