RLG00000003232

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0003066
Physical Location & Seq
Reverse (-)
45898873 .. 45901670
2798 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000003232

Sequence Viewer

Length: 651 bp
ATGACAGTAGACAGCGGCACCATGGAAGACATGGAAGCCAAGGCCGAGCAGCTCGGTATCCAATTCTCCTCCATAGACTTGAACTCTGCACACCCACCTCACTTCAATTTCGGTGAATGCCAAGAAGTGTTTTACGACGACAATGGTTTCATTCCCAATATTGAGTTTGGGAGTGTGATCGTGGTCAATAACCTTCCCATTGTTGAGGCAGAGATGGCCCAGGAGCTTGAAAACGAGATTCGAGTGGTGTTTAGTGAAGTTGGTGTTGTTAAAGAAGATGGGTTTTCGATGCCTGTGAATCCCAGCAGCCAAGAAACCTTGGGTCATTGTTTCATAGAGTTTAATTCTCGTCAGGAAGCTGCACTTGCTAGGAACAAGAGAGATGGATACAAGTTTGGTAACTGCAAGATGTCAGTAAGCCTCTATGATGCCTTTGGCAGTTTAGTTGCTACCCCTGACATGATTAATGCACCCTTTTGTGAGTCCTCAAGGTATCCAGGGTCGCCTTCCTTGCTTAGTCCCGTAACAGAGGAAGATGAAGATCCCGTTCACAGTGATGAAACTAGTGCAGATGACCACAACGACATAATGCAGTGGAGTGAGCAAGACAATGATATGAGCAGTGAGGAATTTAGGGAAGTCATTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
RRM_1 eIF2A

Protein Analysis

217

Amino Acids

24.08

Weight (kDa)

4.09

Isoelectric Point (pI)

65.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 77 - 137 4.5e-06 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 17
AccI GTMKAC 1 cut(s) 9
AciI CCGC 1 cut(s) 15
AclWI GGATC 1 cut(s) 536
AcsI RAATTY 1 cut(s) 629
AgsI TTSAA 4 cut(s) 82, 106, 230, 647
AhlI ACTAGT 1 cut(s) 563
AjnI CCWGG 2 cut(s) 219, 496
AluBI AGCT 3 cut(s) 52, 226, 359
AluI AGCT 3 cut(s) 52, 226, 359
AlwI GGATC 1 cut(s) 536
AoxI GGCC 2 cut(s) 42, 216
ApeKI GCWGC 3 cut(s) 49, 306, 359
ApoI RAATTY 1 cut(s) 629
AseI ATTAAT 1 cut(s) 465
AspS9I GGNCC 1 cut(s) 217
AsuHPI GGTGA 1 cut(s) 125
BanI GGYRCC 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 33
BbvI GCAGC 3 cut(s) 61, 318, 346
BccI CCATC 3 cut(s) 208, 272, 377
BciT130I CCWGG 2 cut(s) 221, 498
BciVI GTATCC 3 cut(s) 68, 380, 504
BcuI ACTAGT 1 cut(s) 563
BfaI CTAG 2 cut(s) 369, 564
BfuI GTATCC 3 cut(s) 68, 380, 504
BisI GCNGC 4 cut(s) 16, 50, 307, 360
BlsI GCNGC 4 cut(s) 17, 51, 308, 361
Bme1390I CCNGG 2 cut(s) 221, 498
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 2 cut(s) 221, 498
BmsI GCATC 2 cut(s) 279, 418
BpiI GAAGAC 1 cut(s) 33
BpuEI CTTGAG 1 cut(s) 472
BsaBI GATNNNNATC 1 cut(s) 540
BsaJI CCNNGG 5 cut(s) 21, 39, 219, 318, 497
Bse8I GATNNNNATC 1 cut(s) 540
BseBI CCWGG 2 cut(s) 221, 498
BseDI CCNNGG 5 cut(s) 21, 39, 219, 318, 497
BseJI GATNNNNATC 1 cut(s) 540
BseRI GAGGAG 1 cut(s) 58
BseXI GCAGC 3 cut(s) 61, 318, 346
BseYI CCCAGC 1 cut(s) 302
BsgI GTGCAG 3 cut(s) 72, 345, 588
BshFI GGCC 2 cut(s) 44, 218
BshNI GGYRCC 1 cut(s) 17
BslFI GGGAC 1 cut(s) 504
BsmFI GGGAC 1 cut(s) 504
BsmI GAATGC 1 cut(s) 122
BsnI GGCC 2 cut(s) 44, 218
Bsp143I GATC 2 cut(s) 177, 541
Bsp19I CCATGG 1 cut(s) 21
BspACI CCGC 1 cut(s) 15
BspANI GGCC 2 cut(s) 44, 218
BspLI GGNNCC 1 cut(s) 19
BspPI GGATC 1 cut(s) 536
BspT107I GGYRCC 1 cut(s) 17
BssECI CCNNGG 5 cut(s) 21, 39, 219, 318, 497
BssMI GATC 2 cut(s) 177, 541
BssT1I CCWWGG 3 cut(s) 21, 39, 318
Bst2UI CCWGG 2 cut(s) 221, 498
Bst4CI ACNGT 2 cut(s) 7, 554
BstDEI CTNAG 1 cut(s) 515
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 2 cut(s) 180, 544
BstMBI GATC 2 cut(s) 177, 541
BstMWI GCNNNNNNNGC 3 cut(s) 215, 365, 511
BstNI CCWGG 2 cut(s) 221, 498
BstSCI CCNGG 2 cut(s) 219, 496
BstV1I GCAGC 3 cut(s) 61, 318, 346
BstV2I GAAGAC 1 cut(s) 33
BstX2I RGATCY 1 cut(s) 541
BstYI RGATCY 1 cut(s) 541
BsuI GTATCC 3 cut(s) 68, 380, 504
BsuRI GGCC 2 cut(s) 44, 218
BtgI CCRYGG 1 cut(s) 21
BtsI GCAGTG 2 cut(s) 599, 628
BtsIMutI CAGTG 3 cut(s) 559, 599, 628
Cfr13I GGNCC 1 cut(s) 217
CviAII CATG 3 cut(s) 22, 31, 460
CviJI RGCY 8 cut(s) 38, 44, 52, 218, 226, 309, 359, 420
CviKI_1 RGCY 8 cut(s) 38, 44, 52, 218, 226, 309, 359, 420
DdeI CTNAG 1 cut(s) 515
DpnI GATC 2 cut(s) 179, 543
DpnII GATC 2 cut(s) 177, 541
Eco130I CCWWGG 3 cut(s) 21, 39, 318
EcoRII CCWGG 2 cut(s) 219, 496
EcoT14I CCWWGG 3 cut(s) 21, 39, 318
ErhI CCWWGG 3 cut(s) 21, 39, 318
FaeI CATG 3 cut(s) 25, 34, 463
FaiI YATR 8 cut(s) 23, 32, 74, 335, 426, 461, 587, 617
FalI AAGNNNNNCTT 2 cut(s) 348, 380
FaqI GGGAC 1 cut(s) 504
FatI CATG 3 cut(s) 21, 30, 459
FblI GTMKAC 1 cut(s) 9
Fnu4HI GCNGC 4 cut(s) 16, 50, 307, 360
Fsp4HI GCNGC 4 cut(s) 16, 50, 307, 360
FspBI CTAG 2 cut(s) 369, 564
GluI GCNGC 4 cut(s) 16, 50, 307, 360
GsaI CCCAGC 1 cut(s) 306
HaeIII GGCC 2 cut(s) 44, 218
Hin1II CATG 3 cut(s) 25, 34, 463
HinfI GANTC 3 cut(s) 238, 298, 482
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 2 cut(s) 10, 550
Hpy188III TCNNGA 1 cut(s) 353
Hpy8I GTNNAC 2 cut(s) 10, 550
Hpy99I CGWCG 1 cut(s) 140
HpyAV CCTTC 2 cut(s) 203, 516
HpyCH4III ACNGT 2 cut(s) 7, 554
HpyCH4V TGCA 6 cut(s) 89, 362, 405, 470, 569, 592
HpyF10VI GCNNNNNNNGC 3 cut(s) 215, 365, 511
HpyF3I CTNAG 1 cut(s) 515
Hsp92II CATG 3 cut(s) 25, 34, 463
Kzo9I GATC 2 cut(s) 177, 541
LmnI GCTCC 1 cut(s) 223
LpnPI CCDG 8 cut(s) 206, 233, 306, 316, 338, 468, 483, 510
Lsp1109I GCAGC 3 cut(s) 61, 318, 346
LweI GCATC 2 cut(s) 279, 418
MaeI CTAG 2 cut(s) 369, 564
MaeIII GTNAC 2 cut(s) 398, 523
MalI GATC 2 cut(s) 179, 543
MboI GATC 2 cut(s) 177, 541
MboII GAAGA 4 cut(s) 38, 287, 545, 551
MflI RGATCY 1 cut(s) 541
MluCI AATT 4 cut(s) 62, 106, 343, 629
MlyI GAGTC 1 cut(s) 491
MnlI CCTC 7 cut(s) 79, 108, 199, 431, 496, 523, 619
MseI TTAA 3 cut(s) 270, 342, 465
MslI CAYNNNNRTG 1 cut(s) 555
MspA1I CMGCKG 1 cut(s) 15
MspR9I CCNGG 2 cut(s) 221, 498
Mva1269I GAATGC 1 cut(s) 122
MvaI CCWGG 2 cut(s) 221, 498
MwoI GCNNNNNNNGC 3 cut(s) 215, 365, 511
NcoI CCATGG 1 cut(s) 21
NdeII GATC 2 cut(s) 177, 541
NlaIII CATG 3 cut(s) 25, 34, 463
NlaIV GGNNCC 1 cut(s) 19
NmeAIII GCCGAG 1 cut(s) 70
PctI GAATGC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 238, 298
PkrI GCNGC 4 cut(s) 17, 51, 308, 361
PleI GAGTC 1 cut(s) 490
PpsI GAGTC 1 cut(s) 490
PshBI ATTAAT 1 cut(s) 465
Psp6I CCWGG 2 cut(s) 219, 496
PspFI CCCAGC 1 cut(s) 302
PspGI CCWGG 2 cut(s) 219, 496
PspN4I GGNNCC 1 cut(s) 19
PspPI GGNCC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 541
RseI CAYNNNNRTG 1 cut(s) 555
SaqAI TTAA 3 cut(s) 270, 342, 465
SatI GCNGC 4 cut(s) 16, 50, 307, 360
Sau3AI GATC 2 cut(s) 177, 541
Sau96I GGNCC 1 cut(s) 217
SchI GAGTC 1 cut(s) 491
ScrFI CCNGG 2 cut(s) 221, 498
SetI ASST 7 cut(s) 54, 100, 195, 228, 320, 361, 494
SfaNI GCATC 2 cut(s) 279, 418
SmiMI CAYNNNNRTG 1 cut(s) 555
SmlI CTYRAG 1 cut(s) 487
SmoI CTYRAG 1 cut(s) 487
SpeI ACTAGT 1 cut(s) 563
Sse9I AATT 4 cut(s) 62, 106, 343, 629
SsiI CCGC 1 cut(s) 15
SspI AATATT 1 cut(s) 160
SspMI CTAG 2 cut(s) 369, 564
StyD4I CCNGG 2 cut(s) 219, 496
StyI CCWWGG 3 cut(s) 21, 39, 318
TaaI ACNGT 2 cut(s) 7, 554
TaqI TCGA 2 cut(s) 241, 287
TasI AATT 4 cut(s) 62, 106, 343, 629
TauI GCSGC 1 cut(s) 18
TfiI GAWTC 2 cut(s) 238, 298
Tru1I TTAA 3 cut(s) 270, 342, 465
Tru9I TTAA 3 cut(s) 270, 342, 465
TscAI CASTG 3 cut(s) 559, 599, 628
TseI GCWGC 3 cut(s) 49, 306, 359
TspDTI ATGAA 4 cut(s) 139, 322, 552, 573
TspRI CASTG 3 cut(s) 559, 599, 628
VspI ATTAAT 1 cut(s) 465
XapI RAATTY 1 cut(s) 629
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 9
XspI CTAG 2 cut(s) 369, 564
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.