Rroxscaffold_3G00250610

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0003066
Physical Location & Seq
Reverse (-)
44425368 .. 44428403
3036 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00250610.1

Sequence Viewer

Length: 651 bp
ATGACAGTAGACAGCGCCACCATGGAAGACATGGAAGCCAAGGCGGAGCAGCTCGGTATCCAATTCTCCTCCATGGACTTGAACTCTGCACACCCACCTCACTTTAATTTCAGTGAATGCCAAGAAGTGTTTTACGACGACAATGGTTTCATCCCCAATATTGAGTTTGGGAGTGTGATCGTGGTCAATAACCTTCCCATTGTTGAGGCAGAGATGGCCCAGGAGCTTGAAAACGAGATTCGAGTGGTGTTTAGTGAAGTTGGTGTTATTAAAGAAGATGGGTTTTCGATGCCTGTGAATCCCAGCACCCAAGAAACCTTGGGTCATTGTTTCATAGAGTTTAATTCTCGTCAGGAAGCTGCACTTGCTAGGAACAAGAGAGATGGATACAAGTTTGGTAACTGCAAGATGTCAGTAAGCCTCTATGATGCCTTTGGCAGTTTAGTTGCTACCCCTGACATGATAGATGCATCCTTTTGTGGGTCCTCAAGGTATCCAGGGTCGCCTTCCTTGCTTAGTCCCGTAACAGAGGAAGACGAAGACCCCGTTCATAGTGATGAAACTAGTGCAGATGACCACAATGACATAATGCAGTGGAGTGAGCAAGACAATGATATGAGCAGTGAGGAATTTAGGGAAGTCATTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
RRM_1 eIF2A

Protein Analysis

216

Amino Acids

24.09

Weight (kDa)

4.08

Isoelectric Point (pI)

62.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 77 - 137 4.4e-07 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 9
AciI CCGC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 629
AfiI CCNNNNNNNGG 1 cut(s) 480
AgsI TTSAA 3 cut(s) 82, 230, 647
AhlI ACTAGT 1 cut(s) 563
AjnI CCWGG 2 cut(s) 219, 496
AluBI AGCT 3 cut(s) 52, 226, 359
AluI AGCT 3 cut(s) 52, 226, 359
AoxI GGCC 1 cut(s) 216
ApeKI GCWGC 2 cut(s) 49, 359
ApoI RAATTY 1 cut(s) 629
AspLEI GCGC 1 cut(s) 17
AspS9I GGNCC 2 cut(s) 217, 483
AvaII GGWCC 1 cut(s) 483
BbsI GAAGAC 3 cut(s) 33, 540, 546
BbvI GCAGC 2 cut(s) 61, 346
BccI CCATC 3 cut(s) 208, 272, 377
BciT130I CCWGG 2 cut(s) 221, 498
BciVI GTATCC 3 cut(s) 68, 380, 504
BcuI ACTAGT 1 cut(s) 563
BfaI CTAG 2 cut(s) 369, 564
BfoI RGCGCY 1 cut(s) 18
BfuI GTATCC 3 cut(s) 68, 380, 504
BisI GCNGC 2 cut(s) 50, 360
BlsI GCNGC 2 cut(s) 51, 361
Bme1390I CCNGG 2 cut(s) 221, 498
Bme18I GGWCC 1 cut(s) 483
BmgT120I GGNCC 2 cut(s) 217, 483
BmiI GGNNCC 1 cut(s) 484
BmrFI CCNGG 2 cut(s) 221, 498
BmsI GCATC 4 cut(s) 279, 418, 457, 479
BpiI GAAGAC 3 cut(s) 33, 540, 546
BpuEI CTTGAG 1 cut(s) 472
BsaJI CCNNGG 6 cut(s) 21, 39, 72, 219, 318, 497
Bsc4I CCNNNNNNNGG 1 cut(s) 480
BseBI CCWGG 2 cut(s) 221, 498
BseDI CCNNGG 6 cut(s) 21, 39, 72, 219, 318, 497
BseGI GGATG 2 cut(s) 150, 470
BseLI CCNNNNNNNGG 1 cut(s) 480
BseRI GAGGAG 1 cut(s) 58
BseXI GCAGC 2 cut(s) 61, 346
BseYI CCCAGC 1 cut(s) 302
BsgI GTGCAG 3 cut(s) 72, 345, 588
BshFI GGCC 1 cut(s) 218
BslFI GGGAC 1 cut(s) 504
BslI CCNNNNNNNGG 1 cut(s) 480
BsmFI GGGAC 1 cut(s) 504
BsmI GAATGC 1 cut(s) 122
BsnI GGCC 1 cut(s) 218
Bsp143I GATC 1 cut(s) 177
Bsp19I CCATGG 2 cut(s) 21, 72
BspACI CCGC 1 cut(s) 44
BspANI GGCC 1 cut(s) 218
BspLI GGNNCC 1 cut(s) 484
BssECI CCNNGG 6 cut(s) 21, 39, 72, 219, 318, 497
BssMI GATC 1 cut(s) 177
BssT1I CCWWGG 4 cut(s) 21, 39, 72, 318
Bst2UI CCWGG 2 cut(s) 221, 498
Bst4CI ACNGT 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 515
BstDSI CCRYGG 2 cut(s) 21, 72
BstF5I GGATG 2 cut(s) 150, 470
BstH2I RGCGCY 1 cut(s) 18
BstHHI GCGC 1 cut(s) 17
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstMWI GCNNNNNNNGC 3 cut(s) 215, 365, 511
BstNI CCWGG 2 cut(s) 221, 498
BstSCI CCNGG 2 cut(s) 219, 496
BstV1I GCAGC 2 cut(s) 61, 346
BstV2I GAAGAC 3 cut(s) 33, 540, 546
BsuI GTATCC 3 cut(s) 68, 380, 504
BsuRI GGCC 1 cut(s) 218
BtgI CCRYGG 2 cut(s) 21, 72
BtsCI GGATG 2 cut(s) 150, 470
BtsI GCAGTG 2 cut(s) 599, 628
BtsIMutI CAGTG 3 cut(s) 118, 599, 628
CfoI GCGC 1 cut(s) 17
Cfr13I GGNCC 2 cut(s) 217, 483
CviAII CATG 4 cut(s) 22, 31, 73, 460
CviJI RGCY 6 cut(s) 38, 52, 218, 226, 359, 420
CviKI_1 RGCY 6 cut(s) 38, 52, 218, 226, 359, 420
DdeI CTNAG 1 cut(s) 515
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
EciI GGCGGA 1 cut(s) 59
Eco130I CCWWGG 4 cut(s) 21, 39, 72, 318
Eco47I GGWCC 1 cut(s) 483
EcoO109I RGGNCCY 1 cut(s) 483
EcoRII CCWGG 2 cut(s) 219, 496
EcoT14I CCWWGG 4 cut(s) 21, 39, 72, 318
EcoT22I ATGCAT 1 cut(s) 472
ErhI CCWWGG 4 cut(s) 21, 39, 72, 318
FaeI CATG 4 cut(s) 25, 34, 76, 463
FaiI YATR 9 cut(s) 23, 32, 74, 335, 426, 461, 552, 587, 617
FalI AAGNNNNNCTT 2 cut(s) 348, 380
FaqI GGGAC 1 cut(s) 504
FatI CATG 4 cut(s) 21, 30, 72, 459
FblI GTMKAC 1 cut(s) 9
Fnu4HI GCNGC 2 cut(s) 50, 360
FokI GGATG 2 cut(s) 137, 457
Fsp4HI GCNGC 2 cut(s) 50, 360
FspBI CTAG 2 cut(s) 369, 564
GlaI GCGC 1 cut(s) 16
GluI GCNGC 2 cut(s) 50, 360
GsaI CCCAGC 1 cut(s) 306
HaeII RGCGCY 1 cut(s) 18
HaeIII GGCC 1 cut(s) 218
HhaI GCGC 1 cut(s) 17
Hin1II CATG 4 cut(s) 25, 34, 76, 463
Hin6I GCGC 1 cut(s) 15
HinP1I GCGC 1 cut(s) 15
HinfI GANTC 2 cut(s) 238, 298
Hpy166II GTNNAC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 353
Hpy8I GTNNAC 1 cut(s) 10
Hpy99I CGWCG 1 cut(s) 140
HpyAV CCTTC 2 cut(s) 203, 516
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4V TGCA 6 cut(s) 89, 362, 405, 470, 569, 592
HpyF10VI GCNNNNNNNGC 3 cut(s) 215, 365, 511
HpyF3I CTNAG 1 cut(s) 515
Hsp92II CATG 4 cut(s) 25, 34, 76, 463
HspAI GCGC 1 cut(s) 15
Kzo9I GATC 1 cut(s) 177
LmnI GCTCC 2 cut(s) 46, 223
LpnPI CCDG 8 cut(s) 206, 233, 306, 316, 338, 468, 483, 510
Lsp1109I GCAGC 2 cut(s) 61, 346
LweI GCATC 4 cut(s) 279, 418, 457, 479
MaeI CTAG 2 cut(s) 369, 564
MaeIII GTNAC 2 cut(s) 398, 523
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MboII GAAGA 4 cut(s) 38, 287, 545, 551
MluCI AATT 4 cut(s) 62, 106, 343, 629
MnlI CCTC 7 cut(s) 79, 108, 199, 431, 496, 523, 619
Mph1103I ATGCAT 1 cut(s) 472
MseI TTAA 3 cut(s) 105, 270, 342
MslI CAYNNNNRTG 1 cut(s) 555
MspR9I CCNGG 2 cut(s) 221, 498
Mva1269I GAATGC 1 cut(s) 122
MvaI CCWGG 2 cut(s) 221, 498
MwoI GCNNNNNNNGC 3 cut(s) 215, 365, 511
NcoI CCATGG 2 cut(s) 21, 72
NdeII GATC 1 cut(s) 177
NlaIII CATG 4 cut(s) 25, 34, 76, 463
NlaIV GGNNCC 1 cut(s) 484
NsiI ATGCAT 1 cut(s) 472
PcsI WCGNNNNNNNCGW 1 cut(s) 543
PctI GAATGC 1 cut(s) 122
PfeI GAWTC 2 cut(s) 238, 298
PkrI GCNGC 2 cut(s) 51, 361
PpuMI RGGWCCY 1 cut(s) 483
Psp5II RGGWCCY 1 cut(s) 483
Psp6I CCWGG 2 cut(s) 219, 496
PspFI CCCAGC 1 cut(s) 302
PspGI CCWGG 2 cut(s) 219, 496
PspN4I GGNNCC 1 cut(s) 484
PspPI GGNCC 2 cut(s) 217, 483
PspPPI RGGWCCY 1 cut(s) 483
RseI CAYNNNNRTG 1 cut(s) 555
SaqAI TTAA 3 cut(s) 105, 270, 342
SatI GCNGC 2 cut(s) 50, 360
Sau3AI GATC 1 cut(s) 177
Sau96I GGNCC 2 cut(s) 217, 483
ScrFI CCNGG 2 cut(s) 221, 498
SetI ASST 7 cut(s) 54, 100, 195, 228, 320, 361, 494
SfaNI GCATC 4 cut(s) 279, 418, 457, 479
SinI GGWCC 1 cut(s) 483
SmiMI CAYNNNNRTG 1 cut(s) 555
SmlI CTYRAG 1 cut(s) 487
SmoI CTYRAG 1 cut(s) 487
SpeI ACTAGT 1 cut(s) 563
Sse9I AATT 4 cut(s) 62, 106, 343, 629
SsiI CCGC 1 cut(s) 44
SspI AATATT 1 cut(s) 160
SspMI CTAG 2 cut(s) 369, 564
StyD4I CCNGG 2 cut(s) 219, 496
StyI CCWWGG 4 cut(s) 21, 39, 72, 318
TaaI ACNGT 1 cut(s) 7
TaqI TCGA 2 cut(s) 241, 287
TasI AATT 4 cut(s) 62, 106, 343, 629
TfiI GAWTC 2 cut(s) 238, 298
Tru1I TTAA 3 cut(s) 105, 270, 342
Tru9I TTAA 3 cut(s) 105, 270, 342
TscAI CASTG 3 cut(s) 118, 599, 628
TseI GCWGC 2 cut(s) 49, 359
TspDTI ATGAA 4 cut(s) 139, 322, 539, 573
TspRI CASTG 3 cut(s) 118, 599, 628
VpaK11BI GGWCC 1 cut(s) 483
XapI RAATTY 1 cut(s) 629
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
XmiI GTMKAC 1 cut(s) 9
XspI CTAG 2 cut(s) 369, 564
Zsp2I ATGCAT 1 cut(s) 472
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.