Rmu_co7962606.1_g000001

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7962606.1
Physical Location & Seq
Forward (+)
61 .. 375
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7962606.1_g000001.1.cds

Sequence Viewer

Length: 315 bp
atgattcacagtgaatgccaagaagtgttttacgacgacaacggtttcattcccaatattgagtttgggagtgtgatcgtggttaataaccttcccattgtggaggcagagatggcccaggagctcgaaagcgagattcgggtggtgtttagtgaagttggtgttgttaaagaagatgggttttcgatgcctgtgaatcccagcacccaagaaaccttgggtcattgtttcatagagtttaattctcgtcaggtagttgctttattcctatgctctgttttagtttcaattgtttcttgggtttgtttagtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.6

Weight (kDa)

4.09

Isoelectric Point (pI)

58.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 288
AjnI CCWGG 1 cut(s) 117
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
Alw21I GWGCWC 1 cut(s) 126
AoxI GGCC 1 cut(s) 114
AspS9I GGNCC 1 cut(s) 115
BanII GRGCYC 1 cut(s) 126
Bbv12I GWGCWC 1 cut(s) 126
BccI CCATC 2 cut(s) 106, 170
BciT130I CCWGG 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 115
BmrFI CCNGG 1 cut(s) 119
BmsI GCATC 1 cut(s) 177
BsaJI CCNNGG 2 cut(s) 117, 216
BseBI CCWGG 1 cut(s) 119
BseDI CCNNGG 2 cut(s) 117, 216
BseYI CCCAGC 1 cut(s) 200
BshFI GGCC 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 126
BsmI GAATGC 1 cut(s) 20
BsnI GGCC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 126
Bsp143I GATC 1 cut(s) 75
BspANI GGCC 1 cut(s) 116
BssECI CCNNGG 2 cut(s) 117, 216
BssMI GATC 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 216
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 2 cut(s) 11, 44
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNI CCWGG 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 2 cut(s) 116, 124
CviKI_1 RGCY 2 cut(s) 116, 124
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Ecl136II GAGCTC 1 cut(s) 124
Eco130I CCWWGG 1 cut(s) 216
Eco24I GRGCYC 1 cut(s) 126
Eco53kI GAGCTC 1 cut(s) 124
EcoICRI GAGCTC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 216
EcoT38I GRGCYC 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 216
FaiI YATR 2 cut(s) 233, 271
FriOI GRGCYC 1 cut(s) 126
GsaI CCCAGC 1 cut(s) 204
HaeIII GGCC 1 cut(s) 116
HinfI GANTC 3 cut(s) 4, 136, 196
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 101
HpyCH4III ACNGT 2 cut(s) 11, 44
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 5 cut(s) 104, 131, 204, 214, 236
LweI GCATC 1 cut(s) 177
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 185
MfeI CAATTG 1 cut(s) 288
MhlI GDGCHC 1 cut(s) 126
MluCI AATT 2 cut(s) 241, 288
MnlI CCTC 1 cut(s) 97
MseI TTAA 3 cut(s) 84, 168, 240
MspR9I CCNGG 1 cut(s) 119
MunI CAATTG 1 cut(s) 288
Mva1269I GAATGC 1 cut(s) 20
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 75
PctI GAATGC 1 cut(s) 20
PfeI GAWTC 3 cut(s) 4, 136, 196
Psp124BI GAGCTC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 117
PspFI CCCAGC 1 cut(s) 200
PspGI CCWGG 1 cut(s) 117
PspPI GGNCC 1 cut(s) 115
SacI GAGCTC 1 cut(s) 126
SaqAI TTAA 3 cut(s) 84, 168, 240
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 119
SduI GDGCHC 1 cut(s) 126
SetI ASST 4 cut(s) 93, 126, 218, 255
SfaNI GCATC 1 cut(s) 177
Sse9I AATT 2 cut(s) 241, 288
SspI AATATT 1 cut(s) 58
SstI GAGCTC 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 117
StyI CCWWGG 1 cut(s) 216
TaaI ACNGT 2 cut(s) 11, 44
TaqI TCGA 2 cut(s) 126, 185
TasI AATT 2 cut(s) 241, 288
TfiI GAWTC 3 cut(s) 4, 136, 196
Tru1I TTAA 3 cut(s) 84, 168, 240
Tru9I TTAA 3 cut(s) 84, 168, 240
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 2 cut(s) 37, 220
TspRI CASTG 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.