Rh7DG243300

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
25074715 .. 25074867
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG243300.1

Sequence Viewer

Length: 153 bp
ATGGTTCACAGTGAATGCCAAGAAGTGTTTTACGATGACAATGGTTTCTTCCCCAATATTGAGTTTGGGAGTGTGATCGTGGTTAATAACCTTCCCATTGTGGAGGCAGAGATGGCCCAGGAGCTCGAAAGCGAAATTCGAGTGTGTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.69

Weight (kDa)

4.05

Isoelectric Point (pI)

71.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 135
AjnI CCWGG 1 cut(s) 117
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
Alw21I GWGCWC 1 cut(s) 126
AoxI GGCC 1 cut(s) 114
ApoI RAATTY 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 115
BanII GRGCYC 1 cut(s) 126
Bbv12I GWGCWC 1 cut(s) 126
BccI CCATC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 115
BmrFI CCNGG 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 117
BshFI GGCC 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 126
BsmI GAATGC 1 cut(s) 20
BsnI GGCC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 126
Bsp143I GATC 1 cut(s) 75
BspANI GGCC 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 117
BssMI GATC 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 11
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstNI CCWGG 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 2 cut(s) 116, 124
CviKI_1 RGCY 2 cut(s) 116, 124
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Ecl136II GAGCTC 1 cut(s) 124
Eco24I GRGCYC 1 cut(s) 126
Eco53kI GAGCTC 1 cut(s) 124
EcoICRI GAGCTC 1 cut(s) 124
EcoRII CCWGG 1 cut(s) 117
EcoT38I GRGCYC 1 cut(s) 126
FriOI GRGCYC 1 cut(s) 126
HaeIII GGCC 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 101
HpyCH4III ACNGT 1 cut(s) 11
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
Kzo9I GATC 1 cut(s) 75
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 2 cut(s) 104, 131
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 40
MhlI GDGCHC 1 cut(s) 126
MluCI AATT 1 cut(s) 135
MnlI CCTC 1 cut(s) 97
MseI TTAA 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 119
Mva1269I GAATGC 1 cut(s) 20
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 75
PctI GAATGC 1 cut(s) 20
Psp124BI GAGCTC 1 cut(s) 126
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
PspPI GGNCC 1 cut(s) 115
SacI GAGCTC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 1 cut(s) 119
SduI GDGCHC 1 cut(s) 126
SetI ASST 2 cut(s) 93, 126
SgeI CNNG 5 cut(s) 32, 91, 130, 131, 137
Sse9I AATT 1 cut(s) 135
SspI AATATT 1 cut(s) 58
SstI GAGCTC 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 11
TaqI TCGA 2 cut(s) 126, 139
TasI AATT 1 cut(s) 135
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 1 cut(s) 16
TspRI CASTG 1 cut(s) 16
XapI RAATTY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.