RchiOBHm_Chr7g0235341

Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
60091159 .. 60094009
2851 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21093

Sequence Viewer

Length: 306 bp
ATGAAATCCTTCTTCTATCTAGACGCTGCACAATCTCTCTCCCTGTCATCACAGACGCCGCCTCACACACACCCTCCCTCTGACGCTGCCTCAACCTCTCATCACGATTTCGGGTTGGAAATCAAAGCCTCAATCAAGTCATCAAGGTATCCAGGGTCTCCTTCCTTGCTTAGTCTCATAACAGAGGAAGACGAAGAACCCGTTCATAGTGATGAAACTAGTGCAGATGACCATGACGACATAATGCAGTGGAGTGAGCAAGACAATGATATGAGCAGTGAGGAATTTGGGGAAGTCATTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.18

Weight (kDa)

4.22

Isoelectric Point (pI)

69.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 59
AcsI RAATTY 1 cut(s) 284
AcyI GRCGYC 1 cut(s) 56
AgsI TTSAA 1 cut(s) 302
AhlI ACTAGT 1 cut(s) 218
AjnI CCWGG 1 cut(s) 151
Alw26I GTCTC 2 cut(s) 162, 179
ApeKI GCWGC 2 cut(s) 26, 86
ApoI RAATTY 1 cut(s) 284
Asp700I GAANNNNTTC 2 cut(s) 8, 201
BbsI GAAGAC 1 cut(s) 195
BbvI GCAGC 2 cut(s) 13, 73
BciT130I CCWGG 1 cut(s) 153
BciVI GTATCC 1 cut(s) 159
BcoDI GTCTC 2 cut(s) 162, 179
BcuI ACTAGT 1 cut(s) 218
BfaI CTAG 2 cut(s) 20, 219
BfuI GTATCC 1 cut(s) 159
BisI GCNGC 3 cut(s) 27, 59, 87
BlsI GCNGC 3 cut(s) 28, 60, 88
Bme1390I CCNGG 1 cut(s) 153
BmrFI CCNGG 1 cut(s) 153
BpiI GAAGAC 1 cut(s) 195
BsaHI GRCGYC 1 cut(s) 56
BsaI GGTCTC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 152
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
BseBI CCWGG 1 cut(s) 153
BseDI CCNNGG 1 cut(s) 152
BseXI GCAGC 2 cut(s) 13, 73
BsgI GTGCAG 2 cut(s) 12, 243
BsmAI GTCTC 2 cut(s) 162, 179
Bso31I GGTCTC 1 cut(s) 162
BspACI CCGC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 162
BssECI CCNNGG 1 cut(s) 152
BssNI GRCGYC 1 cut(s) 56
Bst2UI CCWGG 1 cut(s) 153
BstACI GRCGYC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 170
BstMAI GTCTC 2 cut(s) 162, 179
BstNI CCWGG 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 151
BstV1I GCAGC 2 cut(s) 13, 73
BstV2I GAAGAC 1 cut(s) 195
BsuI GTATCC 1 cut(s) 159
BtsI GCAGTG 2 cut(s) 254, 283
BtsIMutI CAGTG 2 cut(s) 254, 283
CseI GACGC 3 cut(s) 32, 64, 92
CviAII CATG 1 cut(s) 233
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
DdeI CTNAG 1 cut(s) 170
Eco31I GGTCTC 1 cut(s) 162
EcoRII CCWGG 1 cut(s) 151
FaeI CATG 1 cut(s) 236
FaiI YATR 5 cut(s) 179, 207, 234, 242, 272
FatI CATG 1 cut(s) 232
Fnu4HI GCNGC 3 cut(s) 27, 59, 87
Fsp4HI GCNGC 3 cut(s) 27, 59, 87
FspBI CTAG 2 cut(s) 20, 219
GluI GCNGC 3 cut(s) 27, 59, 87
HgaI GACGC 3 cut(s) 32, 64, 92
Hin1I GRCGYC 1 cut(s) 56
Hin1II CATG 1 cut(s) 236
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 20, 104
HpyAV CCTTC 2 cut(s) 19, 171
HpyCH4V TGCA 3 cut(s) 29, 224, 247
HpyF3I CTNAG 1 cut(s) 170
Hsp92I GRCGYC 1 cut(s) 56
Hsp92II CATG 1 cut(s) 236
LpnPI CCDG 3 cut(s) 56, 138, 165
Lsp1109I GCAGC 2 cut(s) 13, 73
MaeI CTAG 2 cut(s) 20, 219
MboII GAAGA 3 cut(s) 4, 200, 206
MluCI AATT 1 cut(s) 284
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 8 cut(s) 72, 84, 88, 100, 106, 139, 178, 274
MroXI GAANNNNTTC 2 cut(s) 8, 201
MslI CAYNNNNRTG 1 cut(s) 210
MspR9I CCNGG 1 cut(s) 153
MvaI CCWGG 1 cut(s) 153
NlaIII CATG 1 cut(s) 236
PcsI WCGNNNNNNNCGW 1 cut(s) 198
PdmI GAANNNNTTC 2 cut(s) 8, 201
PkrI GCNGC 3 cut(s) 28, 60, 88
Psp6I CCWGG 1 cut(s) 151
PspGI CCWGG 1 cut(s) 151
RseI CAYNNNNRTG 1 cut(s) 210
SatI GCNGC 3 cut(s) 27, 59, 87
ScrFI CCNGG 1 cut(s) 153
SetI ASST 2 cut(s) 98, 149
SmiMI CAYNNNNRTG 1 cut(s) 210
SpeI ACTAGT 1 cut(s) 218
Sse9I AATT 1 cut(s) 284
SsiI CCGC 1 cut(s) 59
SspMI CTAG 2 cut(s) 20, 219
StyD4I CCNGG 1 cut(s) 151
TasI AATT 1 cut(s) 284
TauI GCSGC 1 cut(s) 61
TscAI CASTG 2 cut(s) 254, 283
TseI GCWGC 2 cut(s) 26, 86
TspDTI ATGAA 3 cut(s) 17, 194, 228
TspRI CASTG 2 cut(s) 254, 283
XapI RAATTY 1 cut(s) 284
XbaI TCTAGA 1 cut(s) 19
XmnI GAANNNNTTC 2 cut(s) 8, 201
XspI CTAG 2 cut(s) 20, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.