RchiOBHm_Chr1g0319091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
6782114 .. 6782975
862 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ54934

Sequence Viewer

Length: 123 bp
ATGAGATGTGGGAAAGGAAAGCAAATCACTTCTACACACAAAAAGACATTGATCAGGTCCGGGCCGAGTGGGCAAAGTATGTCAGCCAATTTCAACAAAGCTAGTGTGTCGAGAAGATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.38

Weight (kDa)

12.0

Isoelectric Point (pI)

72.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
AoxI GGCC 1 cut(s) 62
AspS9I GGNCC 2 cut(s) 57, 62
AsuC2I CCSGG 1 cut(s) 61
AvaII GGWCC 1 cut(s) 57
BclI TGATCA 1 cut(s) 51
BcnI CCSGG 1 cut(s) 61
BfaI CTAG 1 cut(s) 102
BglI GCCNNNNNGGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 61
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 2 cut(s) 57, 62
BmrFI CCNGG 1 cut(s) 61
BpuMI CCSGG 1 cut(s) 61
BshFI GGCC 1 cut(s) 64
BsiSI CCGG 1 cut(s) 60
BsnI GGCC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 51
BspANI GGCC 1 cut(s) 64
BssMI GATC 1 cut(s) 51
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 59
BsuRI GGCC 1 cut(s) 64
Cfr13I GGNCC 2 cut(s) 57, 62
CviJI RGCY 3 cut(s) 64, 86, 101
CviKI_1 RGCY 3 cut(s) 64, 86, 101
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 57
FaiI YATR 1 cut(s) 80
FbaI TGATCA 1 cut(s) 51
FspBI CTAG 1 cut(s) 102
FspEI CC 8 cut(s) 40, 45, 46, 54, 55, 73, 78, 100
HaeIII GGCC 1 cut(s) 64
HapII CCGG 1 cut(s) 60
HinfI GANTC 1 cut(s) 117
HpaII CCGG 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
Ksp22I TGATCA 1 cut(s) 51
Kzo9I GATC 1 cut(s) 51
LpnPI CCDG 2 cut(s) 40, 73
MaeI CTAG 1 cut(s) 102
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MluCI AATT 1 cut(s) 88
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 61
MwoI GCNNNNNNNGC 1 cut(s) 70
NciI CCSGG 1 cut(s) 61
NdeII GATC 1 cut(s) 51
NmeAIII GCCGAG 1 cut(s) 90
PfeI GAWTC 1 cut(s) 117
PspPI GGNCC 2 cut(s) 57, 62
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 2 cut(s) 57, 62
ScrFI CCNGG 1 cut(s) 61
SetI ASST 2 cut(s) 59, 103
SgeI CNNG 5 cut(s) 67, 72, 73, 78, 114
SinI GGWCC 1 cut(s) 57
Sse9I AATT 1 cut(s) 88
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 59
TaqI TCGA 1 cut(s) 110
TasI AATT 1 cut(s) 88
TfiI GAWTC 1 cut(s) 117
VpaK11BI GGWCC 1 cut(s) 57
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.