Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007285.1

Orthogroup ID

OG0003062

Physical Location & Seq

Genomic Coordinates Reverse (-)

93594 .. 96241

Gene Structure 2648 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007285.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 474 bp

atgccggcaaaacatgcacaagcacaattttacatcgacaatgttctgcctcgaatcaaggagaagaagataatggccctgaagccttttgttaatcaacttgggtatgtcaatgttcctcaagaaatcaacaggctgaggtgcagggtgaactatcacgctcttaaatttcttcctgaaatagagcagatggctgatttattggcatcaaggatgagaaaccgcaccggaagttccaatccttatatgttaaagagatacttggagatgagaggtgctgatggaggaccagccttggagaagcttatgtgctttgcttgcattttgggtaataagctaagctactgcagtcttctctttccagatcgctttgcttgcatttcaattggatatggcatggaggccatctactttgatgaaggtgcaaggaactcaagaccacaccaactggaaacaagagcattggatgtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000271 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0005975 GO:0005976 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009664 GO:0009832 GO:0009987 GO:0010383 GO:0010393 GO:0012505 GO:0016043 GO:0016051 GO:0017144 GO:0031410 GO:0031982 GO:0031984 GO:0033692 GO:0034637 GO:0034645 GO:0042546 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044036 GO:0044038 GO:0044085 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044262 GO:0044264 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0045229 GO:0045488 GO:0045489 GO:0052325 GO:0052546 GO:0070589 GO:0070592 GO:0071554 GO:0071555 GO:0071669 GO:0071704 GO:0071840 GO:0097708 GO:0098791 GO:1901576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

O-FucT

Protein Analysis

157

Amino Acids

18.01

Weight (kDa)

9.28

Isoelectric Point (pI)

44.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003062)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g07951
malus_domestica	MD12G1248200.v1.1
rosa_chinensis	RchiOBHm_Chr1g0318681 RchiOBHm_Chr1g0319091 RchiOBHm_Chr2g0125271 RchiOBHm_Chr4g0426301 RchiOBHm_Chr7g0187311
rosa_laevigata	RLG00000006896 RLG00000028895
rosa_multiflora	Rmu_sc0001747.1_g000005 Rmu_sc0001877.1_g000012 Rmu_sc0001904.1_g000006 Rmu_sc0002983.1_g000016 Rmu_sc0006382.1_g000008 Rmu_sc0007285.1_g000017
rosa_roxburghii	Rroxscaffold_1G00011350 Rroxscaffold_1G00037350 Rroxscaffold_1G00045990 Rroxscaffold_1G00049060 Rroxscaffold_1G00070310 Rroxscaffold_3G00222330 Rroxscaffold_4G00307450 Rroxscaffold_5G00385990 Rroxscaffold_6G00407860 Rroxscaffold_6G00428470
rosa_rugosa	Rorug01G0107800 Rorug03G0135100 Rorug03G0135200
rosa_samantha	Rh2AG155600 Rh2AG341400 Rh2BG161900 Rh2BG322800 Rh3BG144800 Rh3BG291400 Rh3BG291500 Rh4CG112300 Rh5DG415000
rosa_wichuraiana	Rw6G014080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	223
AcsI	RAATTY	1 cut(s)	167
AcuI	CTGAAG	1 cut(s)	101
AgsI	TTSAA	1 cut(s)	384
AluBI	AGCT	3 cut(s)	304, 337, 342
AluI	AGCT	3 cut(s)	304, 337, 342
AoxI	GGCC	2 cut(s)	75, 402
ApoI	RAATTY	1 cut(s)	167
AspS9I	GGNCC	2 cut(s)	76, 287
AsuHPI	GGTGA	1 cut(s)	160
AvaII	GGWCC	1 cut(s)	287
BbsI	GAAGAC	1 cut(s)	344
BbvCI	CCTCAGC	1 cut(s)	137
BccI	CCATC	3 cut(s)	184, 275, 413
BfmI	CTRYAG	1 cut(s)	346
BlpI	GCTNAGC	1 cut(s)	338
Bme18I	GGWCC	1 cut(s)	287
BmgT120I	GGNCC	2 cut(s)	76, 287
BmsI	GCATC	1 cut(s)	215
BpiI	GAAGAC	1 cut(s)	344
Bpu10I	CCTNAGC	1 cut(s)	137
Bpu1102I	GCTNAGC	1 cut(s)	338
BpuEI	CTTGAG	2 cut(s)	105, 418
BsaJI	CCNNGG	1 cut(s)	294
BsaWI	WCCGGW	1 cut(s)	227
Bse118I	RCCGGY	1 cut(s)	4
Bse1I	ACTGG	1 cut(s)	453
BseDI	CCNNGG	1 cut(s)	294
BseGI	GGATG	2 cut(s)	219, 472
BseMII	CTCAG	1 cut(s)	128
BseNI	ACTGG	1 cut(s)	453
BsgI	GTGCAG	1 cut(s)	163
BshFI	GGCC	2 cut(s)	77, 404
BsiSI	CCGG	2 cut(s)	5, 228
BsnI	GGCC	2 cut(s)	77, 404
Bsp143I	GATC	1 cut(s)	364
Bsp1720I	GCTNAGC	1 cut(s)	338
BspACI	CCGC	1 cut(s)	223
BspANI	GGCC	2 cut(s)	77, 404
BspCNI	CTCAG	1 cut(s)	129
BspMAI	CTGCAG	1 cut(s)	350
BsrFI	RCCGGY	1 cut(s)	4
BsrI	ACTGG	1 cut(s)	453
BssAI	RCCGGY	1 cut(s)	4
BssECI	CCNNGG	1 cut(s)	294
BssMI	GATC	1 cut(s)	364
BssT1I	CCWWGG	1 cut(s)	294
BstAPI	GCANNNNNTGC	1 cut(s)	14
BstC8I	GCNNGC	3 cut(s)	6, 319, 376
BstDEI	CTNAG	2 cut(s)	137, 338
BstF5I	GGATG	2 cut(s)	219, 472
BstKTI	GATC	1 cut(s)	367
BstMBI	GATC	1 cut(s)	364
BstMWI	GCNNNNNNNGC	3 cut(s)	14, 318, 375
BstNSI	RCATGY	1 cut(s)	17
BstSFI	CTRYAG	1 cut(s)	346
BstV2I	GAAGAC	1 cut(s)	344
BsuRI	GGCC	2 cut(s)	77, 404
BtsCI	GGATG	2 cut(s)	219, 472
Cac8I	GCNNGC	3 cut(s)	6, 319, 376
Cfr10I	RCCGGY	1 cut(s)	4
Cfr13I	GGNCC	2 cut(s)	76, 287
CviAII	CATG	2 cut(s)	14, 397
CviJI	RGCY	9 cut(s)	77, 85, 136, 194, 293, 304, 337, 342, 404
CviKI_1	RGCY	9 cut(s)	77, 85, 136, 194, 293, 304, 337, 342, 404
DdeI	CTNAG	2 cut(s)	137, 338
DpnI	GATC	1 cut(s)	366
DpnII	GATC	1 cut(s)	364
Eco130I	CCWWGG	1 cut(s)	294
Eco47I	GGWCC	1 cut(s)	287
Eco57I	CTGAAG	1 cut(s)	101
EcoT14I	CCWWGG	1 cut(s)	294
ErhI	CCWWGG	1 cut(s)	294
FaeI	CATG	2 cut(s)	17, 400
FaiI	YATR	8 cut(s)	15, 108, 246, 248, 308, 393, 398, 472
FalI	AAGNNNNNCTT	2 cut(s)	245, 277
FatI	CATG	2 cut(s)	13, 396
FokI	GGATG	1 cut(s)	226
HaeIII	GGCC	2 cut(s)	77, 404
HapII	CCGG	2 cut(s)	5, 228
Hin1II	CATG	2 cut(s)	17, 400
HindIII	AAGCTT	1 cut(s)	302
HinfI	GANTC	1 cut(s)	54
HpaII	CCGG	2 cut(s)	5, 228
HphI	GGTGA	1 cut(s)	160
Hpy166II	GTNNAC	1 cut(s)	151
Hpy188III	TCNNGA	4 cut(s)	122, 176, 362, 435
Hpy8I	GTNNAC	1 cut(s)	151
HpyAV	CCTTC	1 cut(s)	413
HpyCH4V	TGCA	6 cut(s)	17, 144, 321, 348, 378, 425
HpyF10VI	GCNNNNNNNGC	3 cut(s)	14, 318, 375
HpyF3I	CTNAG	2 cut(s)	137, 338
Hsp92II	CATG	2 cut(s)	17, 400
KroI	GCCGGC	1 cut(s)	4
KroNI	GCCGGC	1 cut(s)	6
Kzo9I	GATC	1 cut(s)	364
LpnPI	CCDG	9 cut(s)	18, 92, 118, 130, 189, 241, 303, 375, 434
LweI	GCATC	1 cut(s)	215
MalI	GATC	1 cut(s)	366
MboI	GATC	1 cut(s)	364
MboII	GAAGA	4 cut(s)	76, 79, 164, 344
MfeI	CAATTG	1 cut(s)	384
MluCI	AATT	3 cut(s)	26, 167, 384
MnlI	CCTC	6 cut(s)	60, 129, 132, 266, 278, 394
MroNI	GCCGGC	1 cut(s)	4
MseI	TTAA	3 cut(s)	93, 165, 251
MspI	CCGG	2 cut(s)	5, 228
MunI	CAATTG	1 cut(s)	384
MwoI	GCNNNNNNNGC	3 cut(s)	14, 318, 375
NaeI	GCCGGC	1 cut(s)	6
NdeII	GATC	1 cut(s)	364
NgoMIV	GCCGGC	1 cut(s)	4
NlaIII	CATG	2 cut(s)	17, 400
NspI	RCATGY	1 cut(s)	17
PdiI	GCCGGC	1 cut(s)	6
PfeI	GAWTC	1 cut(s)	54
PspPI	GGNCC	2 cut(s)	76, 287
PstI	CTGCAG	1 cut(s)	350
SaqAI	TTAA	3 cut(s)	93, 165, 251
Sau3AI	GATC	1 cut(s)	364
Sau96I	GGNCC	2 cut(s)	76, 287
SetI	ASST	6 cut(s)	143, 277, 306, 339, 344, 424
SfaNI	GCATC	1 cut(s)	215
SfcI	CTRYAG	1 cut(s)	346
SinI	GGWCC	1 cut(s)	287
SmlI	CTYRAG	2 cut(s)	120, 433
SmoI	CTYRAG	2 cut(s)	120, 433
Sse9I	AATT	3 cut(s)	26, 167, 384
SsiI	CCGC	1 cut(s)	223
StyI	CCWWGG	1 cut(s)	294
TaqI	TCGA	2 cut(s)	36, 52
TasI	AATT	3 cut(s)	26, 167, 384
TfiI	GAWTC	1 cut(s)	54
Tru1I	TTAA	3 cut(s)	93, 165, 251
Tru9I	TTAA	3 cut(s)	93, 165, 251
TspDTI	ATGAA	1 cut(s)	432
VpaK11BI	GGWCC	1 cut(s)	287
XapI	RAATTY	1 cut(s)	167
XceI	RCATGY	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.