Rroxscaffold_4G00307450

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
28756740 .. 28761359
4620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00307450.1

Sequence Viewer

Length: 282 bp
ATGGCCCTGAAGCCTTTTGTTAATCAACTTGGGTATGTCAATGTTCCTCAAGAAATCAACAGGCTGAGGTGCGGGGTGAACTATCACGCTCTTAAATTTCTTCCTGAAATAGAGCAGATGGCTGATTTGTTGGCATCAAGGATGAGAAACCGCACCGGAAGTTCCAATCCTTATATGGCCCTGCATCTTAGGTTTGAGAAGGGCATGTTTGGTCTATCCTTCTGTGGATTTTTGGGGATGCTAAGGTGTTCAAATTTCGGTTTGTATGGTACTTGGAAGTGA

Protein Analysis

93

Amino Acids

10.67

Weight (kDa)

9.66

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
O-FucT PF10250 1 - 76 4.4e-14 GDP-fucose protein O-fucosyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 72, 151
AcsI RAATTY 2 cut(s) 95, 253
AcuI CTGAAG 1 cut(s) 29
AfaI GTAC 1 cut(s) 271
AgsI TTSAA 1 cut(s) 252
AoxI GGCC 2 cut(s) 3, 177
ApoI RAATTY 2 cut(s) 95, 253
AspS9I GGNCC 2 cut(s) 4, 178
AsuHPI GGTGA 1 cut(s) 88
BbvCI CCTCAGC 1 cut(s) 65
BccI CCATC 1 cut(s) 112
BmgT120I GGNCC 2 cut(s) 4, 178
BmsI GCATC 3 cut(s) 143, 193, 228
Bpu10I CCTNAGC 2 cut(s) 65, 242
BpuEI CTTGAG 1 cut(s) 33
BsaWI WCCGGW 1 cut(s) 155
BseGI GGATG 2 cut(s) 147, 243
BseMII CTCAG 1 cut(s) 56
BshFI GGCC 2 cut(s) 5, 179
BsiSI CCGG 1 cut(s) 156
BsnI GGCC 2 cut(s) 5, 179
BspACI CCGC 2 cut(s) 72, 151
BspANI GGCC 2 cut(s) 5, 179
BspCNI CTCAG 1 cut(s) 57
BstDEI CTNAG 3 cut(s) 65, 188, 242
BstF5I GGATG 2 cut(s) 147, 243
BstNSI RCATGY 1 cut(s) 208
BsuRI GGCC 2 cut(s) 5, 179
BtsCI GGATG 2 cut(s) 147, 243
Cfr13I GGNCC 2 cut(s) 4, 178
Csp6I GTAC 1 cut(s) 270
CviAII CATG 1 cut(s) 205
CviJI RGCY 5 cut(s) 5, 13, 64, 122, 179
CviKI_1 RGCY 5 cut(s) 5, 13, 64, 122, 179
CviQI GTAC 1 cut(s) 270
DdeI CTNAG 3 cut(s) 65, 188, 242
Eco57I CTGAAG 1 cut(s) 29
FaeI CATG 1 cut(s) 208
FaiI YATR 5 cut(s) 36, 174, 176, 206, 267
FatI CATG 1 cut(s) 204
FauI CCCGC 1 cut(s) 65
FokI GGATG 2 cut(s) 154, 250
HaeIII GGCC 2 cut(s) 5, 179
HapII CCGG 1 cut(s) 156
Hin1II CATG 1 cut(s) 208
HpaII CCGG 1 cut(s) 156
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 79
Hpy188III TCNNGA 2 cut(s) 50, 104
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 2 cut(s) 193, 229
HpyCH4V TGCA 1 cut(s) 184
HpyF3I CTNAG 3 cut(s) 65, 188, 242
Hsp92II CATG 1 cut(s) 208
LpnPI CCDG 5 cut(s) 20, 46, 117, 169, 194
LweI GCATC 3 cut(s) 143, 193, 228
MboII GAAGA 1 cut(s) 92
MluCI AATT 2 cut(s) 95, 253
MnlI CCTC 2 cut(s) 57, 60
MseI TTAA 2 cut(s) 21, 93
MspI CCGG 1 cut(s) 156
NlaIII CATG 1 cut(s) 208
NspI RCATGY 1 cut(s) 208
PspPI GGNCC 2 cut(s) 4, 178
RsaI GTAC 1 cut(s) 271
RsaNI GTAC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 21, 93
Sau96I GGNCC 2 cut(s) 4, 178
SetI ASST 3 cut(s) 71, 194, 248
SfaNI GCATC 3 cut(s) 143, 193, 228
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
Sse9I AATT 2 cut(s) 95, 253
SsiI CCGC 2 cut(s) 72, 151
TasI AATT 2 cut(s) 95, 253
Tru1I TTAA 2 cut(s) 21, 93
Tru9I TTAA 2 cut(s) 21, 93
XapI RAATTY 2 cut(s) 95, 253
XceI RCATGY 1 cut(s) 208
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.