Rroxscaffold_5G00385990

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
64980527 .. 64981041
515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00385990.1

Sequence Viewer

Length: 153 bp
ATGACATTTTCCAGGAAAAGGAAAAGAAGGGTAGCTGCAAAATCTTTGTCTATGGATGCTTATCTAAATGCTATTAAGATTGAGAAAATAGGGCACGCATATCAGCTTAATCCTAATGCCCCTAAAGAAAGAGTTGATAAGAGAGTACTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.81

Weight (kDa)

10.76

Isoelectric Point (pI)

48.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 18
AjnI CCWGG 1 cut(s) 11
AluBI AGCT 2 cut(s) 35, 106
AluI AGCT 2 cut(s) 35, 106
ApeKI GCWGC 1 cut(s) 35
ArsI GACNNNNNNTTYG 2 cut(s) 32, 64
BaeGI GKGCMC 1 cut(s) 96
BbvI GCAGC 1 cut(s) 22
BciT130I CCWGG 1 cut(s) 13
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
BmcAI AGTACT 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 13
BmrFI CCNGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 46
BsaBI GATNNNNATC 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 18
Bse8I GATNNNNATC 1 cut(s) 60
BseBI CCWGG 1 cut(s) 13
BseGI GGATG 1 cut(s) 61
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 1 cut(s) 18
BseSI GKGCMC 1 cut(s) 96
BseXI GCAGC 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 96
BstF5I GGATG 1 cut(s) 61
BstNI CCWGG 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 11
BstSLI GKGCMC 1 cut(s) 96
BstV1I GCAGC 1 cut(s) 22
BtsCI GGATG 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 96
Csp6I GTAC 1 cut(s) 146
CviJI RGCY 2 cut(s) 35, 106
CviKI_1 RGCY 2 cut(s) 35, 106
CviQI GTAC 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 11
FaiI YATR 3 cut(s) 53, 100, 151
Fnu4HI GCNGC 1 cut(s) 36
FokI GGATG 1 cut(s) 68
Fsp4HI GCNGC 1 cut(s) 36
GluI GCNGC 1 cut(s) 36
HpyAV CCTTC 1 cut(s) 21
HpyCH4V TGCA 1 cut(s) 38
LpnPI CCDG 1 cut(s) 25
Lsp1109I GCAGC 1 cut(s) 22
LweI GCATC 1 cut(s) 46
MhlI GDGCHC 1 cut(s) 96
MseI TTAA 2 cut(s) 75, 108
MspR9I CCNGG 1 cut(s) 13
MvaI CCWGG 1 cut(s) 13
PfoI TCCNGGA 1 cut(s) 11
PkrI GCNGC 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 11
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 2 cut(s) 75, 108
SatI GCNGC 1 cut(s) 36
ScaI AGTACT 1 cut(s) 147
ScrFI CCNGG 1 cut(s) 13
SduI GDGCHC 1 cut(s) 96
SetI ASST 2 cut(s) 37, 108
SfaNI GCATC 1 cut(s) 46
SgeI CNNG 3 cut(s) 24, 25, 107
StyD4I CCNGG 1 cut(s) 11
TatI WGTACW 1 cut(s) 145
Tru1I TTAA 2 cut(s) 75, 108
Tru9I TTAA 2 cut(s) 75, 108
TseI GCWGC 1 cut(s) 35
ZrmI AGTACT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.