RchiOBHm_Chr2g0125271

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
38845789 .. 38861030
15242 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49739

Sequence Viewer

Length: 255 bp
ATGGCCCTGAAGTCTTTTGTTAATCAACTTGGGTATGTCAATGTTCCTCAAGAAATCAACAGGCTGAGGTGCGGGGTGAACTATCACGCTCTTAAATTTCTTCCTGAAATAGAGCAGATGGCTGATTTATTGGCATCAAGGATGAGAAACCGCACCGGAAGTTCCAATCCTTATATGGTCCTGCATCTTAGGTTTGAGAACGGCATGGTAGATCTATCCTTCTGTGATTTTTTGGGGATGCTAAGGTCAGGTTGA

Protein Analysis

84

Amino Acids

9.63

Weight (kDa)

8.77

Isoelectric Point (pI)

51.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
O-FucT PF10250 2 - 78 4.5e-14 GDP-fucose protein O-fucosyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 72, 151
AcsI RAATTY 1 cut(s) 95
AcuI CTGAAG 1 cut(s) 29
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 95
AspS9I GGNCC 2 cut(s) 4, 178
AsuHPI GGTGA 1 cut(s) 88
AvaII GGWCC 1 cut(s) 178
BbvCI CCTCAGC 1 cut(s) 65
BccI CCATC 1 cut(s) 112
BceAI ACGGC 1 cut(s) 217
BglII AGATCT 1 cut(s) 211
Bme18I GGWCC 1 cut(s) 178
BmgT120I GGNCC 2 cut(s) 4, 178
BmsI GCATC 3 cut(s) 143, 193, 228
Bpu10I CCTNAGC 2 cut(s) 65, 242
BpuEI CTTGAG 1 cut(s) 33
BsaWI WCCGGW 1 cut(s) 155
BseGI GGATG 2 cut(s) 147, 243
BseMII CTCAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 156
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 211
BspACI CCGC 2 cut(s) 72, 151
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 57
BssMI GATC 1 cut(s) 211
BstDEI CTNAG 3 cut(s) 65, 188, 242
BstF5I GGATG 2 cut(s) 147, 243
BstKTI GATC 1 cut(s) 214
BstMBI GATC 1 cut(s) 211
BstX2I RGATCY 1 cut(s) 211
BstYI RGATCY 1 cut(s) 211
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 147, 243
Cfr13I GGNCC 2 cut(s) 4, 178
CviAII CATG 1 cut(s) 205
CviJI RGCY 3 cut(s) 5, 64, 122
CviKI_1 RGCY 3 cut(s) 5, 64, 122
DdeI CTNAG 3 cut(s) 65, 188, 242
DpnI GATC 1 cut(s) 213
DpnII GATC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 178
Eco57I CTGAAG 1 cut(s) 29
FaeI CATG 1 cut(s) 208
FaiI YATR 4 cut(s) 36, 174, 176, 206
FatI CATG 1 cut(s) 204
FauI CCCGC 1 cut(s) 65
FokI GGATG 2 cut(s) 154, 250
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 156
Hin1II CATG 1 cut(s) 208
HpaII CCGG 1 cut(s) 156
HphI GGTGA 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 79
Hpy188III TCNNGA 2 cut(s) 50, 104
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 229
HpyCH4V TGCA 1 cut(s) 184
HpyF3I CTNAG 3 cut(s) 65, 188, 242
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 211
LpnPI CCDG 6 cut(s) 20, 46, 117, 169, 194, 234
LweI GCATC 3 cut(s) 143, 193, 228
MalI GATC 1 cut(s) 213
MboI GATC 1 cut(s) 211
MboII GAAGA 1 cut(s) 92
MflI RGATCY 1 cut(s) 211
MluCI AATT 1 cut(s) 95
MnlI CCTC 2 cut(s) 57, 60
MseI TTAA 2 cut(s) 21, 93
MspI CCGG 1 cut(s) 156
NdeII GATC 1 cut(s) 211
NlaIII CATG 1 cut(s) 208
PspPI GGNCC 2 cut(s) 4, 178
PsuI RGATCY 1 cut(s) 211
SaqAI TTAA 2 cut(s) 21, 93
Sau3AI GATC 1 cut(s) 211
Sau96I GGNCC 2 cut(s) 4, 178
SetI ASST 4 cut(s) 71, 194, 248, 253
SfaNI GCATC 3 cut(s) 143, 193, 228
SinI GGWCC 1 cut(s) 178
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
Sse9I AATT 1 cut(s) 95
SsiI CCGC 2 cut(s) 72, 151
TasI AATT 1 cut(s) 95
Tru1I TTAA 2 cut(s) 21, 93
Tru9I TTAA 2 cut(s) 21, 93
VpaK11BI GGWCC 1 cut(s) 178
XapI RAATTY 1 cut(s) 95
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.