Rroxscaffold_6G00428470

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
48830265 .. 48833429
3165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00428470.1

Sequence Viewer

Length: 159 bp
ATGACCACTCTGTATAGGTATGTCAATGTTCCTCAAGAAATCAACAGGTTGAGGTGCGAGGTGAACTATCGCGCTCATAAATTTCTTCCTGAAATAGAGCAGATGGCTGATTTATTGGCATCAAGGATGAGAAACTGCAATTATATGACTACAGTCTAG

Protein Analysis

52

Amino Acids

6.3

Weight (kDa)

8.77

Isoelectric Point (pI)

58.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 72
AcsI RAATTY 1 cut(s) 80
ApoI RAATTY 1 cut(s) 80
AspLEI GCGC 1 cut(s) 74
AsuHPI GGTGA 1 cut(s) 73
BccI CCATC 1 cut(s) 97
BfaI CTAG 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 150
BmsI GCATC 1 cut(s) 128
BoxI GACNNNNGTC 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 18
BseGI GGATG 1 cut(s) 132
Bsh1236I CGCG 1 cut(s) 72
BspFNI CGCG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 154
BstF5I GGATG 1 cut(s) 132
BstFNI CGCG 1 cut(s) 72
BstHHI GCGC 1 cut(s) 74
BstPAI GACNNNNGTC 1 cut(s) 152
BstSFI CTRYAG 1 cut(s) 150
BstUI CGCG 1 cut(s) 72
BtsCI GGATG 1 cut(s) 132
CfoI GCGC 1 cut(s) 74
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
FaiI YATR 5 cut(s) 15, 21, 78, 144, 146
FokI GGATG 1 cut(s) 139
FspBI CTAG 1 cut(s) 157
FspEI CC 9 cut(s) 19, 31, 37, 44, 45, 89, 101, 102, 109
GlaI GCGC 1 cut(s) 73
HhaI GCGC 1 cut(s) 74
Hin6I GCGC 1 cut(s) 72
HinP1I GCGC 1 cut(s) 72
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 64
Hpy188III TCNNGA 2 cut(s) 35, 89
Hpy8I GTNNAC 1 cut(s) 64
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 138
HspAI GCGC 1 cut(s) 72
LpnPI CCDG 2 cut(s) 31, 102
LweI GCATC 1 cut(s) 128
MaeI CTAG 1 cut(s) 157
MboII GAAGA 1 cut(s) 77
MluCI AATT 2 cut(s) 80, 139
MnlI CCTC 3 cut(s) 42, 45, 52
MvnI CGCG 1 cut(s) 72
PshAI GACNNNNGTC 1 cut(s) 152
SetI ASST 4 cut(s) 20, 50, 56, 63
SfaNI GCATC 1 cut(s) 128
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 6 cut(s) 47, 58, 70, 83, 101, 135
SmlI CTYRAG 1 cut(s) 33
SmoI CTYRAG 1 cut(s) 33
Sse9I AATT 2 cut(s) 80, 139
SspMI CTAG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 154
TasI AATT 2 cut(s) 80, 139
XapI RAATTY 1 cut(s) 80
XspI CTAG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.