Rh3BG291500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
29172148 .. 29174650
2503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG291500.1

Sequence Viewer

Length: 222 bp
ATGTTCCTTAGAAGCCATGTTAATATTGAGTTGGAATGGCTTGGAAGCAAGGAGATCGATCGATCCATCGATGAGCTTGCTATGAAACAGAGTGAAGGCTTGAACAATAAGGAGCAGCACAAGGCAAAACATTCCAAAACATGCACCAGCACAATTTTACATCAACAATGTTCTGGCTCGAATCAAGGAGAAGAAGATAATGGCCCTGAAGCCTTTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.25

Weight (kDa)

5.45

Isoelectric Point (pI)

72.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 57
AgsI TTSAA 1 cut(s) 103
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
AlwI GGATC 1 cut(s) 57
AoxI GGCC 1 cut(s) 202
ApeKI GCWGC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 203
BbvI GCAGC 1 cut(s) 127
BccI CCATC 1 cut(s) 74
BcgI CGANNNNNNTGC 4 cut(s) 37, 59, 71, 93
BisI GCNGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 203
Bsa29I ATCGAT 3 cut(s) 57, 61, 69
BseCI ATCGAT 3 cut(s) 57, 61, 69
BseXI GCAGC 1 cut(s) 127
Bsh1285I CGRYCG 1 cut(s) 61
BshFI GGCC 1 cut(s) 204
BshVI ATCGAT 3 cut(s) 57, 61, 69
BsiEI CGRYCG 1 cut(s) 61
BsnI GGCC 1 cut(s) 204
Bsp143I GATC 3 cut(s) 54, 58, 62
BspANI GGCC 1 cut(s) 204
BspDI ATCGAT 3 cut(s) 57, 61, 69
BspPI GGATC 1 cut(s) 57
BssMI GATC 3 cut(s) 54, 58, 62
BstC8I GCNNGC 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 8
BstKTI GATC 3 cut(s) 57, 61, 65
BstMBI GATC 3 cut(s) 54, 58, 62
BstMCI CGRYCG 1 cut(s) 61
BstNSI RCATGY 1 cut(s) 144
BstV1I GCAGC 1 cut(s) 127
Bsu15I ATCGAT 3 cut(s) 57, 61, 69
BsuRI GGCC 1 cut(s) 204
BsuTUI ATCGAT 3 cut(s) 57, 61, 69
Cac8I GCNNGC 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 203
ClaI ATCGAT 3 cut(s) 57, 61, 69
CviAII CATG 2 cut(s) 17, 141
CviJI RGCY 7 cut(s) 15, 40, 76, 99, 177, 204, 212
CviKI_1 RGCY 7 cut(s) 15, 40, 76, 99, 177, 204, 212
DdeI CTNAG 1 cut(s) 8
DpnI GATC 3 cut(s) 56, 60, 64
DpnII GATC 3 cut(s) 54, 58, 62
FaeI CATG 2 cut(s) 20, 144
FaiI YATR 3 cut(s) 18, 83, 142
FatI CATG 2 cut(s) 16, 140
Fnu4HI GCNGC 1 cut(s) 116
Fsp4HI GCNGC 1 cut(s) 116
GluI GCNGC 1 cut(s) 116
HaeIII GGCC 1 cut(s) 204
Hin1II CATG 2 cut(s) 20, 144
HinfI GANTC 1 cut(s) 181
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 2 cut(s) 20, 144
Kzo9I GATC 3 cut(s) 54, 58, 62
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 159, 160
Lsp1109I GCAGC 1 cut(s) 127
MalI GATC 3 cut(s) 56, 60, 64
MboI GATC 3 cut(s) 54, 58, 62
MboII GAAGA 2 cut(s) 203, 206
MluCI AATT 1 cut(s) 153
MmeI TCCRAC 1 cut(s) 12
MseI TTAA 2 cut(s) 21, 220
NdeII GATC 3 cut(s) 54, 58, 62
NlaIII CATG 2 cut(s) 20, 144
NspI RCATGY 1 cut(s) 144
PfeI GAWTC 1 cut(s) 181
PkrI GCNGC 1 cut(s) 117
Ple19I CGATCG 1 cut(s) 61
PspPI GGNCC 1 cut(s) 203
PvuI CGATCG 1 cut(s) 61
SaqAI TTAA 2 cut(s) 21, 220
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 3 cut(s) 54, 58, 62
Sau96I GGNCC 1 cut(s) 203
SetI ASST 1 cut(s) 78
Sse9I AATT 1 cut(s) 153
SspI AATATT 1 cut(s) 25
TaqI TCGA 4 cut(s) 57, 61, 69, 179
TasI AATT 1 cut(s) 153
TfiI GAWTC 1 cut(s) 181
Tru1I TTAA 2 cut(s) 21, 220
Tru9I TTAA 2 cut(s) 21, 220
TseI GCWGC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 98
XceI RCATGY 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.