Rroxscaffold_1G00011350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
14319725 .. 14321348
1624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00011350.1

Sequence Viewer

Length: 183 bp
ATGAAAAGTACCATAGGACAAACCAAGATTCCCCAACCCGTGAAAGATTCTGCTATGGGTCGTCCAAGATGGGAAAGGAAAGCAAATCACTTCTACACACAAAAAGACATTGATCAGGTCCGGCCGAGTGGGCAAAGTATGTCAGCCAATTTCAACAAAGCTAGTGTGTCGAGAAGATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.9

Weight (kDa)

11.04

Isoelectric Point (pI)

66.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 122
AfaI GTAC 1 cut(s) 10
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
AoxI GGCC 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 118
AvaII GGWCC 1 cut(s) 118
BccI CCATC 1 cut(s) 63
BclI TGATCA 1 cut(s) 112
BfaI CTAG 1 cut(s) 162
BglI GCCNNNNNGGC 1 cut(s) 130
Bme18I GGWCC 1 cut(s) 118
BmgT120I GGNCC 1 cut(s) 118
BseX3I CGGCCG 1 cut(s) 122
Bsh1285I CGRYCG 1 cut(s) 125
BshFI GGCC 1 cut(s) 124
BsiEI CGRYCG 1 cut(s) 125
BsiSI CCGG 1 cut(s) 121
BsnI GGCC 1 cut(s) 124
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 1 cut(s) 124
BssMI GATC 1 cut(s) 112
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMCI CGRYCG 1 cut(s) 125
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstZI CGGCCG 1 cut(s) 122
BsuRI GGCC 1 cut(s) 124
Cfr13I GGNCC 1 cut(s) 118
Csp6I GTAC 1 cut(s) 9
CviJI RGCY 3 cut(s) 124, 146, 161
CviKI_1 RGCY 3 cut(s) 124, 146, 161
CviQI GTAC 1 cut(s) 9
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 122
EagI CGGCCG 1 cut(s) 122
EclXI CGGCCG 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 118
Eco52I CGGCCG 1 cut(s) 122
FaiI YATR 3 cut(s) 14, 56, 140
FbaI TGATCA 1 cut(s) 112
FspBI CTAG 1 cut(s) 162
HaeIII GGCC 1 cut(s) 124
HapII CCGG 1 cut(s) 121
HinfI GANTC 3 cut(s) 28, 47, 177
HpaII CCGG 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 171
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 101, 134
MaeI CTAG 1 cut(s) 162
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MluCI AATT 1 cut(s) 148
MspI CCGG 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 1 cut(s) 112
NmeAIII GCCGAG 1 cut(s) 150
PfeI GAWTC 3 cut(s) 28, 47, 177
PspPI GGNCC 1 cut(s) 118
RsaI GTAC 1 cut(s) 10
RsaNI GTAC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 118
SetI ASST 2 cut(s) 120, 163
SgeI CNNG 8 cut(s) 37, 50, 52, 78, 128, 133, 138, 174
SinI GGWCC 1 cut(s) 118
Sse9I AATT 1 cut(s) 148
SspMI CTAG 1 cut(s) 162
TaqI TCGA 1 cut(s) 170
TasI AATT 1 cut(s) 148
TfiI GAWTC 3 cut(s) 28, 47, 177
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 118
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.