RchiOBHm_Chr1g0324131

Glutamate-gated receptor that probably acts as non- selective cation channel

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
11752350 .. 11753426
1077 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55398

Sequence Viewer

Length: 246 bp
ATGCAAGACAAGAACACTGCTTACACTGACCTTGTGCATTTGGGTGCCTGTGGAAGTGATGGCTCAAACTGGAAATGCATCATGCATGCCACCGTTTCGTCTAGGAGGCCGAGTTCTTTGAATATTGGAGCTTTGTTTACTAATTCAGACATTGGAAGGTCGGCCAAACCAGCAATCCTAGCCCCAATTGATGAGGTTAATTATGGGTCAAAGAGTTGGAGGTTGAAGGTGGGAGGACTGTGGTGA

Protein Analysis

81

Amino Acids

8.74

Weight (kDa)

9.14

Isoelectric Point (pI)

51.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 44
AcoI YGGCCR 1 cut(s) 162
AgsI TTSAA 2 cut(s) 121, 226
AloI GAACNNNNNNTCC 2 cut(s) 97, 129
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
AoxI GGCC 2 cut(s) 107, 162
BanI GGYRCC 1 cut(s) 44
BccI CCATC 1 cut(s) 53
BfaI CTAG 2 cut(s) 102, 179
BmiI GGNNCC 1 cut(s) 46
BmsI GCATC 1 cut(s) 87
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bse1I ACTGG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 74
BshFI GGCC 2 cut(s) 109, 164
BshNI GGYRCC 1 cut(s) 44
BsnI GGCC 2 cut(s) 109, 164
BspANI GGCC 2 cut(s) 109, 164
BspLI GGNNCC 1 cut(s) 46
BspT107I GGYRCC 1 cut(s) 44
BsrI ACTGG 1 cut(s) 74
Bst4CI ACNGT 2 cut(s) 94, 240
BstC8I GCNNGC 1 cut(s) 87
BstMWI GCNNNNNNNGC 2 cut(s) 170, 179
BstNSI RCATGY 1 cut(s) 89
BsuRI GGCC 2 cut(s) 109, 164
BtsI GCAGTG 1 cut(s) 15
BtsIMutI CAGTG 2 cut(s) 15, 24
Cac8I GCNNGC 1 cut(s) 87
CviAII CATG 2 cut(s) 82, 86
CviJI RGCY 5 cut(s) 63, 109, 131, 164, 182
CviKI_1 RGCY 5 cut(s) 63, 109, 131, 164, 182
EaeI YGGCCR 1 cut(s) 162
EcoT22I ATGCAT 2 cut(s) 80, 87
FaeI CATG 2 cut(s) 85, 89
FaiI YATR 3 cut(s) 83, 87, 204
FatI CATG 2 cut(s) 81, 85
FspBI CTAG 2 cut(s) 102, 179
HaeIII GGCC 2 cut(s) 109, 164
Hin1II CATG 2 cut(s) 85, 89
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 2 cut(s) 150, 220
HpyCH4III ACNGT 2 cut(s) 94, 240
HpyCH4V TGCA 4 cut(s) 4, 37, 78, 85
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 179
Hsp92II CATG 2 cut(s) 85, 89
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 3 cut(s) 55, 61, 183
LweI GCATC 1 cut(s) 87
MaeI CTAG 2 cut(s) 102, 179
MfeI CAATTG 1 cut(s) 186
MluCI AATT 3 cut(s) 142, 186, 199
MmeI TCCRAC 1 cut(s) 197
MnlI CCTC 4 cut(s) 99, 187, 213, 227
Mph1103I ATGCAT 2 cut(s) 80, 87
MseI TTAA 1 cut(s) 198
MslI CAYNNNNRTG 1 cut(s) 42
MunI CAATTG 1 cut(s) 186
MwoI GCNNNNNNNGC 2 cut(s) 170, 179
NlaIII CATG 2 cut(s) 85, 89
NlaIV GGNNCC 1 cut(s) 46
NmeAIII GCCGAG 1 cut(s) 135
NsiI ATGCAT 2 cut(s) 80, 87
NspI RCATGY 1 cut(s) 89
PaeI GCATGC 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 46
PsrI GAACNNNNNNTAC 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 198
SetI ASST 6 cut(s) 33, 133, 161, 198, 224, 231
SfaNI GCATC 1 cut(s) 87
SmiMI CAYNNNNRTG 1 cut(s) 42
SphI GCATGC 1 cut(s) 89
Sse9I AATT 3 cut(s) 142, 186, 199
SspI AATATT 1 cut(s) 124
SspMI CTAG 2 cut(s) 102, 179
TaaI ACNGT 2 cut(s) 94, 240
TasI AATT 3 cut(s) 142, 186, 199
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TscAI CASTG 2 cut(s) 22, 31
TspRI CASTG 2 cut(s) 22, 31
XceI RCATGY 1 cut(s) 89
XspI CTAG 2 cut(s) 102, 179
Zsp2I ATGCAT 2 cut(s) 80, 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.