RchiOBHm_Chr2g0123231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
36373755 .. 36374532
778 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49555

Sequence Viewer

Length: 219 bp
ATGAGCAAAGCTTTTTCACCCCCAAAGAGAAGAGGTAGCCAAGCTAACTCTGTGATGGGTTCTTGCAGCAGAAGAAGAGAGGATGAAGGCTCTGAAAATCCAGGCTTCTACAAGCGTGTTGATTACTCTATTCTTCTAAAAATGAAGCTTGTAAATTCCCTCAACTTCTTCATAATCACCTTTCTTTTAGGTAGATTTTCTTCACTTTCGGAAAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.17

Weight (kDa)

10.12

Isoelectric Point (pI)

86.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 154
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 4 cut(s) 11, 44, 148, 216
AluI AGCT 4 cut(s) 11, 44, 148, 216
ApeKI GCWGC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 154
AsuHPI GGTGA 2 cut(s) 9, 169
BarI GAAGNNNNNNTAC 2 cut(s) 184, 216
BbvI GCAGC 1 cut(s) 78
BccI CCATC 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 102
BisI GCNGC 1 cut(s) 67
BlsI GCNGC 1 cut(s) 68
Bme1390I CCNGG 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 102
BseGI GGATG 1 cut(s) 88
BseXI GCAGC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 102
Bst6I CTCTTC 2 cut(s) 25, 70
BstF5I GGATG 1 cut(s) 88
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstV1I GCAGC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 88
CviJI RGCY 7 cut(s) 11, 39, 44, 90, 105, 148, 216
CviKI_1 RGCY 7 cut(s) 11, 39, 44, 90, 105, 148, 216
Eam1104I CTCTTC 2 cut(s) 25, 70
EarI CTCTTC 2 cut(s) 25, 70
EcoRII CCWGG 1 cut(s) 100
FaiI YATR 1 cut(s) 173
Fnu4HI GCNGC 1 cut(s) 67
FokI GGATG 1 cut(s) 95
Fsp4HI GCNGC 1 cut(s) 67
GluI GCNGC 1 cut(s) 67
HindIII AAGCTT 2 cut(s) 9, 146
HphI GGTGA 2 cut(s) 9, 169
Hpy188I TCNGA 2 cut(s) 94, 211
HpyAV CCTTC 1 cut(s) 80
HpyCH4V TGCA 1 cut(s) 66
LpnPI CCDG 2 cut(s) 87, 114
Lsp1109I GCAGC 1 cut(s) 78
MboII GAAGA 6 cut(s) 42, 84, 87, 125, 160, 192
MluCI AATT 1 cut(s) 154
MnlI CCTC 3 cut(s) 26, 73, 170
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
PkrI GCNGC 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
SatI GCNGC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 102
SetI ASST 7 cut(s) 13, 37, 46, 150, 182, 193, 218
SgeI CNNG 7 cut(s) 53, 75, 113, 114, 124, 128, 161
Sse9I AATT 1 cut(s) 154
StyD4I CCNGG 1 cut(s) 100
TasI AATT 1 cut(s) 154
TseI GCWGC 1 cut(s) 66
TspDTI ATGAA 3 cut(s) 99, 158, 160
XapI RAATTY 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.