Rorug04G0316900

B3 DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
49107944 .. 49108295
352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0316900.1

Sequence Viewer

Length: 225 bp
ATGAAGCTAGATGAGGTTTCAGCTAGGACCATGGAGGTATTGGTGGATGCTTTTTCTAGTTCTGCAGGGCTGTCCACCTTCTCCTATACTGATGAGTTGGACTATGAATGGGGTGAACAGAATAGAGATTGCCAGTACGTTGAGGAGGAGGACCTCATGAGGTTCATGATTGAGAAAGAGGTAGAAGTTGCATTTATGCTGATTGACGTAGCACAAACCAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.64

Weight (kDa)

4.05

Isoelectric Point (pI)

23.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 137
AluBI AGCT 2 cut(s) 7, 23
AluI AGCT 2 cut(s) 7, 23
AspS9I GGNCC 2 cut(s) 27, 151
AsuHPI GGTGA 1 cut(s) 125
AvaII GGWCC 2 cut(s) 27, 151
BfaI CTAG 3 cut(s) 8, 24, 57
BfmI CTRYAG 1 cut(s) 63
Bme18I GGWCC 2 cut(s) 27, 151
BmgT120I GGNCC 2 cut(s) 27, 151
BmsI GCATC 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 30
BseGI GGATG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 133
BseRI GAGGAG 2 cut(s) 158, 161
Bsp19I CCATGG 1 cut(s) 30
BspHI TCATGA 2 cut(s) 156, 165
BspMAI CTGCAG 1 cut(s) 67
BsrI ACTGG 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 30
BssT1I CCWWGG 1 cut(s) 30
BstDSI CCRYGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 63
BtgI CCRYGG 1 cut(s) 30
BtsCI GGATG 1 cut(s) 52
CciI TCATGA 2 cut(s) 156, 165
Cfr13I GGNCC 2 cut(s) 27, 151
Csp6I GTAC 1 cut(s) 136
CviAII CATG 3 cut(s) 31, 157, 166
CviJI RGCY 3 cut(s) 7, 23, 70
CviKI_1 RGCY 3 cut(s) 7, 23, 70
CviQI GTAC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 30
Eco47I GGWCC 2 cut(s) 27, 151
EcoO109I RGGNCCY 1 cut(s) 151
EcoT14I CCWWGG 1 cut(s) 30
ErhI CCWWGG 1 cut(s) 30
FaeI CATG 3 cut(s) 34, 160, 169
FaiI YATR 6 cut(s) 32, 87, 105, 158, 167, 197
FatI CATG 3 cut(s) 30, 156, 165
FokI GGATG 1 cut(s) 59
FspBI CTAG 3 cut(s) 8, 24, 57
Hin1II CATG 3 cut(s) 34, 160, 169
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 2 cut(s) 75, 116
Hpy188III TCNNGA 2 cut(s) 157, 166
Hpy8I GTNNAC 2 cut(s) 75, 116
HpyAV CCTTC 1 cut(s) 88
HpyCH4IV ACGT 2 cut(s) 138, 207
HpyCH4V TGCA 2 cut(s) 65, 191
HpySE526I ACGT 2 cut(s) 138, 207
Hsp92II CATG 3 cut(s) 34, 160, 169
LpnPI CCDG 2 cut(s) 51, 146
LweI GCATC 1 cut(s) 37
MaeI CTAG 3 cut(s) 8, 24, 57
MaeII ACGT 2 cut(s) 138, 207
MmeI TCCRAC 1 cut(s) 78
MnlI CCTC 8 cut(s) 7, 28, 136, 139, 142, 153, 164, 172
NcoI CCATGG 1 cut(s) 30
NlaIII CATG 3 cut(s) 34, 160, 169
PagI TCATGA 2 cut(s) 156, 165
PpuMI RGGWCCY 1 cut(s) 151
Psp5II RGGWCCY 1 cut(s) 151
PspPI GGNCC 2 cut(s) 27, 151
PspPPI RGGWCCY 1 cut(s) 151
PstI CTGCAG 1 cut(s) 67
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
Sau96I GGNCC 2 cut(s) 27, 151
SfaNI GCATC 1 cut(s) 37
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 8 cut(s) 20, 36, 43, 69, 78, 145, 169, 178
SinI GGWCC 2 cut(s) 27, 151
SspMI CTAG 3 cut(s) 8, 24, 57
StyI CCWWGG 1 cut(s) 30
TaiI ACGT 2 cut(s) 141, 210
TspDTI ATGAA 3 cut(s) 17, 120, 154
VpaK11BI GGWCC 2 cut(s) 27, 151
XcmI CCANNNNNNNNNTGG 1 cut(s) 37
XspI CTAG 3 cut(s) 8, 24, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.