Rmu_sc0002236.1_g000010

B3 DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002236.1
Physical Location & Seq
Forward (+)
30376 .. 32284
1909 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002236.1_g000010.1.cds

Sequence Viewer

Length: 843 bp
atgggttcttgcagcagaagaagagaggatgaagactctgaagttccaggcttctacaagtgtgttgattattctgttcttctaagggggaagcttaaaatcccccgagatttttgcgagaactttgaaggaaagatgcctcagcagtgtcgtcttcagactctttatggaacttggcatgttgatgtgaaaaatattagcggagagttcttcttgaaaaagggctggaagaaatttgttgtgggaaatcgtttgaaactaggtgaatgtgtagtctttgattacattggacatgcaaagttctatgttgagatctatggacacaatcactgcagcaagagttctaaggcaatgagaagtgagaggcttcttgatgatgactctgatgatcataatgttgtttttgttgactcggattctgattctgaacctcaaaacagtgaaatcagcttggagtctgaaactgagtgtcctaggaaatcaggttatggaaaaaaattgtcaaggagaggtagagctggtaactcagccaccataagatgttttggtaatccttgcttcagtgttaagatatgccaaactcatgtgaccaagggaccactgcttacaccaaggagcttcatgaggaacatacataagccaaagaaagtcaagcttcaagttggagacatggcctgggatgtgatctggatccatccttaccagcaatctagcaggttcagtggaggttggctacactttgctagccagaacaggttgcaagagggagatttctgtgactttgagctgatttcaaagacaattgaggttgcagtgatgaaggtttctattaggaaaatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

280

Amino Acids

32.17

Weight (kDa)

8.96

Isoelectric Point (pI)

51.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 705
AciI CCGC 1 cut(s) 201
AclWI GGATC 2 cut(s) 685, 698
AcsI RAATTY 1 cut(s) 233
AcuI CTGAAG 3 cut(s) 60, 140, 544
AgsI TTSAA 5 cut(s) 128, 217, 256, 659, 795
AjnI CCWGG 2 cut(s) 46, 674
AluBI AGCT 6 cut(s) 94, 450, 518, 618, 655, 787
AluI AGCT 6 cut(s) 94, 450, 518, 618, 655, 787
Alw26I GTCTC 1 cut(s) 660
AlwI GGATC 2 cut(s) 685, 698
Ama87I CYCGRG 1 cut(s) 105
AoxI GGCC 1 cut(s) 672
ApeKI GCWGC 2 cut(s) 12, 333
ApoI RAATTY 1 cut(s) 233
AspA2I CCTAGG 1 cut(s) 473
AspS9I GGNCC 1 cut(s) 596
AsuHPI GGTGA 1 cut(s) 275
AsuNHI GCTAGC 1 cut(s) 743
AvaI CYCGRG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 596
AvrII CCTAGG 1 cut(s) 473
BamHI GGATCC 1 cut(s) 690
BbsI GAAGAC 2 cut(s) 39, 146
BbvCI CCTCAGC 1 cut(s) 141
BbvI GCAGC 2 cut(s) 24, 345
BccI CCATC 1 cut(s) 702
BcgI CGANNNNNNTGC 2 cut(s) 96, 130
BciT130I CCWGG 2 cut(s) 48, 676
BclI TGATCA 1 cut(s) 388
BcoDI GTCTC 1 cut(s) 660
BfaI CTAG 4 cut(s) 260, 474, 711, 744
BfmI CTRYAG 1 cut(s) 331
BfuAI ACCTGC 1 cut(s) 705
BglII AGATCT 1 cut(s) 312
BisI GCNGC 2 cut(s) 13, 334
BlnI CCTAGG 1 cut(s) 473
BlsI GCNGC 2 cut(s) 14, 335
Bme1390I CCNGG 2 cut(s) 48, 676
Bme18I GGWCC 1 cut(s) 596
BmeT110I CYCGRG 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 596
BmiI GGNNCC 2 cut(s) 597, 692
BmrFI CCNGG 2 cut(s) 48, 676
BmsI GCATC 1 cut(s) 126
BmtI GCTAGC 1 cut(s) 747
BpiI GAAGAC 2 cut(s) 39, 146
Bpu10I CCTNAGC 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 689
BsaJI CCNNGG 4 cut(s) 473, 591, 611, 675
Bse3DI GCAATG 1 cut(s) 357
Bse8I GATNNNNATC 1 cut(s) 689
BseBI CCWGG 2 cut(s) 48, 676
BseDI CCNNGG 4 cut(s) 473, 591, 611, 675
BseGI GGATG 3 cut(s) 34, 685, 694
BseJI GATNNNNATC 1 cut(s) 689
BseMI GCAATG 1 cut(s) 357
BseMII CTCAG 3 cut(s) 155, 456, 540
BseXI GCAGC 2 cut(s) 24, 345
BshFI GGCC 1 cut(s) 674
BsiHKCI CYCGRG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 609
BsmAI GTCTC 1 cut(s) 660
BsmFI GGGAC 1 cut(s) 609
BsnI GGCC 1 cut(s) 674
BsoBI CYCGRG 1 cut(s) 105
Bsp143I GATC 4 cut(s) 312, 388, 684, 690
BspACI CCGC 1 cut(s) 201
BspANI GGCC 1 cut(s) 674
BspCNI CTCAG 3 cut(s) 154, 457, 539
BspHI TCATGA 1 cut(s) 621
BspLI GGNNCC 2 cut(s) 597, 692
BspMAI CTGCAG 1 cut(s) 335
BspMI ACCTGC 1 cut(s) 705
BspOI GCTAGC 1 cut(s) 747
BspPI GGATC 2 cut(s) 685, 698
BsrDI GCAATG 1 cut(s) 357
BssECI CCNNGG 4 cut(s) 473, 591, 611, 675
BssMI GATC 4 cut(s) 312, 388, 684, 690
BssT1I CCWWGG 3 cut(s) 473, 591, 611
Bst2UI CCWGG 2 cut(s) 48, 676
Bst4CI ACNGT 1 cut(s) 440
Bst6I CTCTTC 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 745
BstDEI CTNAG 5 cut(s) 83, 141, 345, 465, 526
BstF5I GGATG 3 cut(s) 34, 685, 694
BstKTI GATC 4 cut(s) 315, 391, 687, 693
BstMAI GTCTC 1 cut(s) 660
BstMBI GATC 4 cut(s) 312, 388, 684, 690
BstNI CCWGG 2 cut(s) 48, 676
BstNSI RCATGY 2 cut(s) 182, 296
BstSCI CCNGG 2 cut(s) 46, 674
BstSFI CTRYAG 1 cut(s) 331
BstV1I GCAGC 2 cut(s) 24, 345
BstV2I GAAGAC 2 cut(s) 39, 146
BstX2I RGATCY 2 cut(s) 312, 690
BstYI RGATCY 2 cut(s) 312, 690
BsuRI GGCC 1 cut(s) 674
BtsCI GGATG 3 cut(s) 34, 685, 694
BtsI GCAGTG 4 cut(s) 152, 328, 599, 819
BtsIMutI CAGTG 7 cut(s) 152, 328, 445, 568, 599, 727, 819
BveI ACCTGC 1 cut(s) 705
Cac8I GCNNGC 1 cut(s) 745
CciI TCATGA 1 cut(s) 621
Cfr13I GGNCC 1 cut(s) 596
CviAII CATG 5 cut(s) 179, 293, 584, 622, 670
DdeI CTNAG 5 cut(s) 83, 141, 345, 465, 526
DpnI GATC 4 cut(s) 314, 390, 686, 692
DpnII GATC 4 cut(s) 312, 388, 684, 690
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
Eco130I CCWWGG 3 cut(s) 473, 591, 611
Eco47I GGWCC 1 cut(s) 596
Eco57I CTGAAG 3 cut(s) 60, 140, 544
Eco88I CYCGRG 1 cut(s) 105
EcoRII CCWGG 2 cut(s) 46, 674
EcoT14I CCWWGG 3 cut(s) 473, 591, 611
ErhI CCWWGG 3 cut(s) 473, 591, 611
FaeI CATG 5 cut(s) 182, 296, 587, 625, 673
FalI AAGNNNNNCTT 2 cut(s) 639, 671
FaqI GGGAC 1 cut(s) 609
FatI CATG 5 cut(s) 178, 292, 583, 621, 669
FbaI TGATCA 1 cut(s) 388
Fnu4HI GCNGC 2 cut(s) 13, 334
FokI GGATG 3 cut(s) 41, 681, 692
Fsp4HI GCNGC 2 cut(s) 13, 334
FspBI CTAG 4 cut(s) 260, 474, 711, 744
GluI GCNGC 2 cut(s) 13, 334
HaeIII GGCC 1 cut(s) 674
Hin1II CATG 5 cut(s) 182, 296, 587, 625, 673
HincII GTYRAC 1 cut(s) 409
HindII GTYRAC 1 cut(s) 409
HindIII AAGCTT 2 cut(s) 92, 653
HinfI GANTC 7 cut(s) 35, 160, 380, 410, 416, 422, 455
HphI GGTGA 1 cut(s) 275
Hpy166II GTNNAC 1 cut(s) 409
Hpy188I TCNGA 7 cut(s) 40, 159, 385, 415, 421, 427, 460
Hpy188III TCNNGA 4 cut(s) 214, 371, 622, 688
Hpy8I GTNNAC 1 cut(s) 409
HpyAV CCTTC 2 cut(s) 122, 814
HpyCH4III ACNGT 1 cut(s) 440
HpyCH4V TGCA 5 cut(s) 12, 296, 333, 760, 812
HpyF3I CTNAG 5 cut(s) 83, 141, 345, 465, 526
Hsp92II CATG 5 cut(s) 182, 296, 587, 625, 673
Ksp22I TGATCA 1 cut(s) 388
Kzo9I GATC 4 cut(s) 312, 388, 684, 690
LmnI GCTCC 1 cut(s) 615
Lsp1109I GCAGC 2 cut(s) 24, 345
LweI GCATC 1 cut(s) 126
MaeI CTAG 4 cut(s) 260, 474, 711, 744
MaeIII GTNAC 3 cut(s) 521, 586, 776
MalI GATC 4 cut(s) 314, 390, 686, 692
MboI GATC 4 cut(s) 312, 388, 684, 690
MboII GAAGA 7 cut(s) 30, 33, 44, 71, 146, 202, 241
MfeI CAATTG 1 cut(s) 801
MflI RGATCY 2 cut(s) 312, 690
MluCI AATT 3 cut(s) 233, 497, 801
MlyI GAGTC 5 cut(s) 29, 154, 374, 404, 464
MmeI TCCRAC 1 cut(s) 643
MnlI CCTC 9 cut(s) 19, 150, 357, 441, 503, 618, 719, 757, 799
MseI TTAA 2 cut(s) 96, 567
MslI CAYNNNNRTG 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 48, 676
MunI CAATTG 1 cut(s) 801
MvaI CCWGG 2 cut(s) 48, 676
NdeII GATC 4 cut(s) 312, 388, 684, 690
NheI GCTAGC 1 cut(s) 743
NlaIII CATG 5 cut(s) 182, 296, 587, 625, 673
NlaIV GGNNCC 2 cut(s) 597, 692
NmuCI GTSAC 2 cut(s) 586, 776
NspI RCATGY 2 cut(s) 182, 296
PagI TCATGA 1 cut(s) 621
PfeI GAWTC 2 cut(s) 416, 422
PkrI GCNGC 2 cut(s) 14, 335
PleI GAGTC 5 cut(s) 29, 154, 374, 404, 463
PpsI GAGTC 5 cut(s) 29, 154, 374, 404, 463
Psp6I CCWGG 2 cut(s) 46, 674
PspGI CCWGG 2 cut(s) 46, 674
PspN4I GGNNCC 2 cut(s) 597, 692
PspPI GGNCC 1 cut(s) 596
PstI CTGCAG 1 cut(s) 335
PsuI RGATCY 2 cut(s) 312, 690
RseI CAYNNNNRTG 1 cut(s) 183
SaqAI TTAA 2 cut(s) 96, 567
SatI GCNGC 2 cut(s) 13, 334
Sau3AI GATC 4 cut(s) 312, 388, 684, 690
Sau96I GGNCC 1 cut(s) 596
SchI GAGTC 5 cut(s) 29, 154, 374, 404, 464
ScrFI CCNGG 2 cut(s) 48, 676
SfaNI GCATC 1 cut(s) 126
SfcI CTRYAG 1 cut(s) 331
SinI GGWCC 1 cut(s) 596
SmiMI CAYNNNNRTG 1 cut(s) 183
Sse9I AATT 3 cut(s) 233, 497, 801
SsiI CCGC 1 cut(s) 201
SspI AATATT 1 cut(s) 196
SspMI CTAG 4 cut(s) 260, 474, 711, 744
StyD4I CCNGG 2 cut(s) 46, 674
StyI CCWWGG 3 cut(s) 473, 591, 611
TaaI ACNGT 1 cut(s) 440
TasI AATT 3 cut(s) 233, 497, 801
TfiI GAWTC 2 cut(s) 416, 422
Tru1I TTAA 2 cut(s) 96, 567
Tru9I TTAA 2 cut(s) 96, 567
TscAI CASTG 7 cut(s) 152, 335, 445, 568, 606, 727, 819
TseFI GTSAC 2 cut(s) 586, 776
TseI GCWGC 2 cut(s) 12, 333
Tsp45I GTSAC 2 cut(s) 586, 776
TspDTI ATGAA 3 cut(s) 45, 610, 833
TspRI CASTG 7 cut(s) 152, 335, 445, 568, 606, 727, 819
VpaK11BI GGWCC 1 cut(s) 596
XapI RAATTY 1 cut(s) 233
XceI RCATGY 2 cut(s) 182, 296
XmaJI CCTAGG 1 cut(s) 473
XspI CTAG 4 cut(s) 260, 474, 711, 744
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.