RchiOBHm_Chr2g0145621

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
63362419 .. 63362917
499 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51547

Sequence Viewer

Length: 198 bp
ATGATTACATCAAAGTTTCCAAAGTCTATTCCAAAATACAATCAAACTTATACAAATTGTAATTGCTCAATCCGTTTGGTAATTCCAATGAAATATGACCAGGGAAGTAGAGAGATGTTGGTGGAGCGAGGCTCGCTTAAATACCCTGATCTCAATTACTTTCCTAGACATCATACTTCATTTGGGTACACCACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.67

Weight (kDa)

9.47

Isoelectric Point (pI)

10.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 188
AjnI CCWGG 1 cut(s) 99
BciT130I CCWGG 1 cut(s) 101
BfaI CTAG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 101
BplI GAGNNNNNCTC 2 cut(s) 116, 148
BsaJI CCNNGG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 100
Bsp143I GATC 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 134
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 134
Csp6I GTAC 1 cut(s) 187
CviAII CATG 1 cut(s) 195
CviJI RGCY 1 cut(s) 132
CviKI_1 RGCY 1 cut(s) 132
CviQI GTAC 1 cut(s) 187
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 198
FaiI YATR 4 cut(s) 51, 96, 174, 196
FatI CATG 1 cut(s) 194
FspBI CTAG 1 cut(s) 165
Hin1II CATG 1 cut(s) 198
Hpy166II GTNNAC 1 cut(s) 189
Hpy8I GTNNAC 1 cut(s) 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
Hsp92II CATG 1 cut(s) 198
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 3 cut(s) 86, 113, 159
MaeI CTAG 1 cut(s) 165
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MluCI AATT 4 cut(s) 55, 61, 81, 154
MnlI CCTC 1 cut(s) 122
MseI TTAA 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 133
NdeII GATC 1 cut(s) 148
NlaIII CATG 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 101
SgeI CNNG 6 cut(s) 112, 113, 140, 145, 158, 177
Sse9I AATT 4 cut(s) 55, 61, 81, 154
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 99
TasI AATT 4 cut(s) 55, 61, 81, 154
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 104, 168
TspGWI ACGGA 1 cut(s) 62
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.