Rroxscaffold_2G00154430

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
91057672 .. 91058219
548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00154430.1

Sequence Viewer

Length: 207 bp
ATGATTACATCAAAGTTTCCAAAGTCTATTCCAAAATACAATCAAACTTATACAAATTGTAATTGCTCAATCCGTTTGGTAATTCCAATGAAATATGACCAGGGAAGTAGAGAGATGTTGGTGGAGCGAGGCTCGCTTAAATACCCCGATCTCAATTACTTTCCTAGACATCATACTTCATTGGGTACGCCACATGAGAAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.99

Weight (kDa)

9.26

Isoelectric Point (pI)

12.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 187
AjnI CCWGG 1 cut(s) 99
BciT130I CCWGG 1 cut(s) 101
BfaI CTAG 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 101
BplI GAGNNNNNCTC 2 cut(s) 116, 148
BsaJI CCNNGG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 101
BseDI CCNNGG 1 cut(s) 100
Bsp143I GATC 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 100
BssMI GATC 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 134
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
Cac8I GCNNGC 1 cut(s) 134
Csp6I GTAC 1 cut(s) 186
CviAII CATG 1 cut(s) 194
CviJI RGCY 1 cut(s) 132
CviKI_1 RGCY 1 cut(s) 132
CviQI GTAC 1 cut(s) 186
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 99
FaeI CATG 1 cut(s) 197
FaiI YATR 4 cut(s) 51, 96, 174, 195
FatI CATG 1 cut(s) 193
FspBI CTAG 1 cut(s) 165
Hin1II CATG 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
Hsp92II CATG 1 cut(s) 197
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 86, 113
MaeI CTAG 1 cut(s) 165
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MluCI AATT 4 cut(s) 55, 61, 81, 154
MnlI CCTC 1 cut(s) 122
MseI TTAA 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 133
NdeII GATC 1 cut(s) 148
NlaIII CATG 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 101
SgeI CNNG 6 cut(s) 112, 113, 140, 145, 158, 177
Sse9I AATT 4 cut(s) 55, 61, 81, 154
SspMI CTAG 1 cut(s) 165
StyD4I CCNGG 1 cut(s) 99
TasI AATT 4 cut(s) 55, 61, 81, 154
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 104, 168
TspGWI ACGGA 1 cut(s) 62
XspI CTAG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.