Rorug05G0481300

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
66224111 .. 66224696
586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0481300.1

Sequence Viewer

Length: 177 bp
ATGGATTTTAACAGGAACAAGATTGAAATGTATGAGTGGCGGAACTATGTAGGAGGCTCCTTGGGCTATAGCCTAACCGAGATTTGGGATGAAAAACCTTCAAAACTCTCCAAGTCTCCATACTCCAATCTGAATGCACAGAACAGCCTGAAATCTTACTTGGGGAGCGTGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.72

Weight (kDa)

7.98

Isoelectric Point (pI)

35.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 2 cut(s) 26, 102
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
Alw26I GTCTC 1 cut(s) 120
BcoDI GTCTC 1 cut(s) 120
BfmI CTRYAG 1 cut(s) 67
BmiI GGNNCC 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 60
BseGI GGATG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 84
BsmAI GTCTC 1 cut(s) 120
BsmI GAATGC 1 cut(s) 139
BspACI CCGC 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 60
BssT1I CCWWGG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 94
BstMAI GTCTC 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 63
BstSFI CTRYAG 1 cut(s) 67
BtsCI GGATG 1 cut(s) 94
CviJI RGCY 4 cut(s) 57, 66, 72, 147
CviKI_1 RGCY 4 cut(s) 57, 66, 72, 147
EciI GGCGGA 1 cut(s) 55
Eco130I CCWWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 60
ErhI CCWWGG 1 cut(s) 60
FaiI YATR 4 cut(s) 33, 48, 69, 121
FokI GGATG 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 132
HpyAV CCTTC 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 63
LmnI GCTCC 2 cut(s) 62, 165
LpnPI CCDG 1 cut(s) 161
MluCI AATT 1 cut(s) 172
MnlI CCTC 1 cut(s) 47
MseI TTAA 1 cut(s) 9
Mva1269I GAATGC 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 63
NlaIV GGNNCC 1 cut(s) 58
PctI GAATGC 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 58
SaqAI TTAA 1 cut(s) 9
SetI ASST 1 cut(s) 100
SfcI CTRYAG 1 cut(s) 67
SgeI CNNG 7 cut(s) 25, 31, 73, 91, 124, 160, 172
Sse9I AATT 1 cut(s) 172
SsiI CCGC 1 cut(s) 40
StyI CCWWGG 1 cut(s) 60
TasI AATT 1 cut(s) 172
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.