RchiOBHm_Chr3g0448291

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0004567
Physical Location & Seq
Reverse (-)
596735 .. 597142
408 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41573

Sequence Viewer

Length: 408 bp
ATGAATTTTGTCTTGCTCATTGCTCTGGCCTTCAATTCAAGTAATGCATGGTGGATAAACCAGCTTGGAAGAAAGAAATTTGTACGCATCGTCAATAATCTGAACAACGGAGAGAGACTAAATTTTCGTTGCCAATCTAAAAACGTTGATCTTGGTGTTCACAGCCTTGCAGTCAATGAGCAATTCCAATTTCACTTTAAAGTCAACTTTTGGGGTCGCACACTTTTTTTTTGCCGTTTGTGGTATTTAGACAAGCATGTTGAAATTGTTGCATTTAAATCTAATCTAGATTTTCAAGAAAATTGTGGCGGAGATCACTGCATATGGATAGGCAAAGAGGATGGAGTATATATGTTTCGCAACAGTAAGAACGAAAATATATTGACATATCTTTGGGAAAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

135

Amino Acids

16.09

Weight (kDa)

8.98

Isoelectric Point (pI)

16.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 28 - 132 6e-28 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 309
AclI AACGTT 1 cut(s) 144
AcsI RAATTY 3 cut(s) 4, 77, 121
AfaI GTAC 1 cut(s) 84
AgsI TTSAA 4 cut(s) 34, 39, 263, 296
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
Alw26I GTCTC 1 cut(s) 109
AoxI GGCC 1 cut(s) 27
ApoI RAATTY 3 cut(s) 4, 77, 121
ArsI GACNNNNNNTTYG 2 cut(s) 108, 140
BccI CCATC 1 cut(s) 335
BceAI ACGGC 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 109
BfaI CTAG 1 cut(s) 287
BmsI GCATC 1 cut(s) 96
Bse3DI GCAATG 1 cut(s) 18
BseGI GGATG 1 cut(s) 346
BseMI GCAATG 1 cut(s) 18
BshFI GGCC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 109
BsnI GGCC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 148, 313
BspACI CCGC 1 cut(s) 309
BspANI GGCC 1 cut(s) 29
BsrDI GCAATG 1 cut(s) 18
BssMI GATC 2 cut(s) 148, 313
Bst4CI ACNGT 1 cut(s) 365
BstF5I GGATG 1 cut(s) 346
BstKTI GATC 2 cut(s) 151, 316
BstMAI GTCTC 1 cut(s) 109
BstMBI GATC 2 cut(s) 148, 313
BstNSI RCATGY 1 cut(s) 260
BsuRI GGCC 1 cut(s) 29
BtsCI GGATG 1 cut(s) 346
BtsI GCAGTG 1 cut(s) 316
BtsIMutI CAGTG 1 cut(s) 316
Csp6I GTAC 1 cut(s) 83
CviAII CATG 2 cut(s) 48, 257
CviJI RGCY 3 cut(s) 29, 64, 165
CviKI_1 RGCY 3 cut(s) 29, 64, 165
CviQI GTAC 1 cut(s) 83
DpnI GATC 2 cut(s) 150, 315
DpnII GATC 2 cut(s) 148, 313
DraI TTTAAA 2 cut(s) 199, 277
EciI GGCGGA 1 cut(s) 324
EcoT22I ATGCAT 1 cut(s) 49
FaeI CATG 2 cut(s) 51, 260
FaiI YATR 9 cut(s) 49, 258, 323, 325, 349, 351, 353, 380, 388
FatI CATG 2 cut(s) 47, 256
FauNDI CATATG 1 cut(s) 323
FokI GGATG 1 cut(s) 353
FspBI CTAG 1 cut(s) 287
HaeIII GGCC 1 cut(s) 29
Hin1II CATG 2 cut(s) 51, 260
HincII GTYRAC 1 cut(s) 205
HindII GTYRAC 1 cut(s) 205
Hpy166II GTNNAC 2 cut(s) 160, 205
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 2 cut(s) 287, 296
Hpy8I GTNNAC 2 cut(s) 160, 205
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 365
HpyCH4IV ACGT 1 cut(s) 144
HpyCH4V TGCA 4 cut(s) 47, 170, 272, 321
HpySE526I ACGT 1 cut(s) 144
Hsp92II CATG 2 cut(s) 51, 260
Kzo9I GATC 2 cut(s) 148, 313
LpnPI CCDG 2 cut(s) 11, 74
LweI GCATC 1 cut(s) 96
MaeI CTAG 1 cut(s) 287
MaeII ACGT 1 cut(s) 144
MalI GATC 2 cut(s) 150, 315
MboI GATC 2 cut(s) 148, 313
MboII GAAGA 1 cut(s) 81
MluCI AATT 9 cut(s) 4, 34, 77, 121, 182, 188, 264, 301, 403
MnlI CCTC 1 cut(s) 331
Mph1103I ATGCAT 1 cut(s) 49
MseI TTAA 2 cut(s) 198, 276
NdeI CATATG 1 cut(s) 323
NdeII GATC 2 cut(s) 148, 313
NlaIII CATG 2 cut(s) 51, 260
NsiI ATGCAT 1 cut(s) 49
NspI RCATGY 1 cut(s) 260
Psp1406I AACGTT 1 cut(s) 144
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
SaqAI TTAA 2 cut(s) 198, 276
Sau3AI GATC 2 cut(s) 148, 313
SetI ASST 2 cut(s) 66, 147
SfaNI GCATC 1 cut(s) 96
SmiI ATTTAAAT 1 cut(s) 277
Sse9I AATT 9 cut(s) 4, 34, 77, 121, 182, 188, 264, 301, 403
SsiI CCGC 1 cut(s) 309
SspMI CTAG 1 cut(s) 287
SwaI ATTTAAAT 1 cut(s) 277
TaaI ACNGT 1 cut(s) 365
TaiI ACGT 1 cut(s) 147
TasI AATT 9 cut(s) 4, 34, 77, 121, 182, 188, 264, 301, 403
Tru1I TTAA 2 cut(s) 198, 276
Tru9I TTAA 2 cut(s) 198, 276
TscAI CASTG 1 cut(s) 323
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 123
TspRI CASTG 1 cut(s) 323
XapI RAATTY 3 cut(s) 4, 77, 121
XbaI TCTAGA 1 cut(s) 286
XceI RCATGY 1 cut(s) 260
XspI CTAG 1 cut(s) 287
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.