RLG00000025927

Plant self-incompatibility protein S1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0004567
Physical Location & Seq
Reverse (-)
49265043 .. 49265415
373 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000025927

Sequence Viewer

Length: 351 bp
ATGAAGCTGGGACAAATTTACTGTGTTGTCTTGCTCATTGCTCTAGCCTTCGGTTCAAGCAATGCATCGATAAACTTTCCTGGGACAAAGAAATTTGTACGCATCGTCAACAATCTGAACAACGGAGAAAGACTTAATCTTCGTTGTCAGTCTAAAGATGATGATCTTGGTGTTCACAGTCTTGCTGTCAATGAGCAATACGAATTTAGCTTTCGGATCAACATCTGGCGAAACACACTTTTCTTTTGCCGTTTATGGTATTCGGACAAGCATACAGAATTTGTTGCATTTAAAATTGTGGCAATCAAGATCATTGCATATGGACAGCCAAAGAGGATGGAGTATACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Self-incomp_S1

Protein Analysis

117

Amino Acids

13.47

Weight (kDa)

9.44

Isoelectric Point (pI)

17.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 33 - 98 3.9e-22 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 344
AclWI GGATC 1 cut(s) 224
AcsI RAATTY 4 cut(s) 15, 92, 203, 278
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 1 cut(s) 57
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 7, 210
AluI AGCT 2 cut(s) 7, 210
AlwI GGATC 1 cut(s) 224
ApoI RAATTY 4 cut(s) 15, 92, 203, 278
ArsI GACNNNNNNTTYG 2 cut(s) 123, 155
BccI CCATC 1 cut(s) 331
BceAI ACGGC 1 cut(s) 234
BciT130I CCWGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 44
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 2 cut(s) 74, 111
Bsa29I ATCGAT 1 cut(s) 68
BsaBI GATNNNNATC 2 cut(s) 162, 221
BsaJI CCNNGG 1 cut(s) 80
Bse3DI GCAATG 3 cut(s) 36, 67, 312
Bse8I GATNNNNATC 2 cut(s) 162, 221
BseBI CCWGG 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 342
BseJI GATNNNNATC 2 cut(s) 162, 221
BseMI GCAATG 3 cut(s) 36, 67, 312
BseYI CCCAGC 1 cut(s) 7
BshVI ATCGAT 1 cut(s) 68
BslFI GGGAC 2 cut(s) 24, 97
BsmFI GGGAC 2 cut(s) 24, 97
Bsp143I GATC 3 cut(s) 163, 216, 309
BspDI ATCGAT 1 cut(s) 68
BspPI GGATC 1 cut(s) 224
BsrDI GCAATG 3 cut(s) 36, 67, 312
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 3 cut(s) 163, 216, 309
BssNAI GTATAC 1 cut(s) 345
Bst1107I GTATAC 1 cut(s) 345
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 23, 179
BstF5I GGATG 1 cut(s) 342
BstKTI GATC 3 cut(s) 166, 219, 312
BstMBI GATC 3 cut(s) 163, 216, 309
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstZ17I GTATAC 1 cut(s) 345
Bsu15I ATCGAT 1 cut(s) 68
BsuTUI ATCGAT 1 cut(s) 68
BtsCI GGATG 1 cut(s) 342
ClaI ATCGAT 1 cut(s) 68
Csp6I GTAC 1 cut(s) 98
CviJI RGCY 4 cut(s) 7, 47, 210, 328
CviKI_1 RGCY 4 cut(s) 7, 47, 210, 328
CviQI GTAC 1 cut(s) 98
DpnI GATC 3 cut(s) 165, 218, 311
DpnII GATC 3 cut(s) 163, 216, 309
DraI TTTAAA 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 79
EcoT22I ATGCAT 1 cut(s) 67
FaiI YATR 5 cut(s) 256, 273, 319, 321, 345
FaqI GGGAC 2 cut(s) 24, 97
FauNDI CATATG 1 cut(s) 319
FblI GTMKAC 1 cut(s) 344
FspBI CTAG 1 cut(s) 44
GsaI CCCAGC 1 cut(s) 11
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
Hpy166II GTNNAC 3 cut(s) 109, 175, 345
Hpy188I TCNGA 3 cut(s) 117, 216, 265
Hpy188III TCNNGA 1 cut(s) 307
Hpy8I GTNNAC 3 cut(s) 109, 175, 345
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 2 cut(s) 23, 179
HpyCH4V TGCA 3 cut(s) 65, 287, 317
Kzo9I GATC 3 cut(s) 163, 216, 309
LpnPI CCDG 3 cut(s) 66, 93, 211
LweI GCATC 2 cut(s) 74, 111
MaeI CTAG 1 cut(s) 44
MalI GATC 3 cut(s) 165, 218, 311
MboI GATC 3 cut(s) 163, 216, 309
MboII GAAGA 1 cut(s) 131
MluCI AATT 5 cut(s) 15, 92, 203, 278, 294
MnlI CCTC 1 cut(s) 327
Mph1103I ATGCAT 1 cut(s) 67
MseI TTAA 2 cut(s) 135, 291
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeI CATATG 1 cut(s) 319
NdeII GATC 3 cut(s) 163, 216, 309
NsiI ATGCAT 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 79
PspFI CCCAGC 1 cut(s) 7
PspGI CCWGG 1 cut(s) 79
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 2 cut(s) 135, 291
Sau3AI GATC 3 cut(s) 163, 216, 309
ScrFI CCNGG 1 cut(s) 81
SetI ASST 2 cut(s) 9, 212
SfaNI GCATC 2 cut(s) 74, 111
Sse9I AATT 5 cut(s) 15, 92, 203, 278, 294
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 23, 179
TaqI TCGA 1 cut(s) 68
TasI AATT 5 cut(s) 15, 92, 203, 278, 294
Tru1I TTAA 2 cut(s) 135, 291
Tru9I TTAA 2 cut(s) 135, 291
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 138
XapI RAATTY 4 cut(s) 15, 92, 203, 278
XmiI GTMKAC 1 cut(s) 344
XspI CTAG 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.