Rh3CG009600

Plant self-incompatibility protein S1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
634378 .. 635079
702 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG009600.1

Sequence Viewer

Length: 408 bp
ATGAAGCTGGGACAAATTTGCTGTGTTGTCTTGCTCATTGCTCTAGCCTTTGGTTCAAGCAATGCATCGATAAACTTTCCTGGGACAAAGAAATTTGTACGCATTGTCAACAATCTAAGCAAAGGAGAAAGACTTAATTTTCATTGTCAATCTAAAGACAACGATATTGGTGTTCGCAGTCTTGCTGTCAATGAGCAATACGAATTTAGCTTTCGGATCAACATCTGGCGAACCACACTTTTCTTTTGCCGTTTATGGTATTCCGACAAGCATGCAAAATTTGTTGCATTTAAAGTTTCTTATGATTTTTATCAAGATTGTGGCAACCAAGATCATTGCATATGGACAGCCAAAGAGGATGGAGTATACTTGAAAGATGAATTGGAAATTTTTTGGGTAAAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

135

Amino Acids

15.77

Weight (kDa)

8.53

Isoelectric Point (pI)

20.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Self-incomp_S1 PF05938 33 - 126 1.2e-28 Plant self-incompatibility protein S1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 366
AclWI GGATC 1 cut(s) 224
AcsI RAATTY 5 cut(s) 15, 92, 203, 278, 387
AfaI GTAC 1 cut(s) 99
AgsI TTSAA 2 cut(s) 57, 373
AjnI CCWGG 1 cut(s) 79
AjuI GAANNNNNNNTTGG 2 cut(s) 365, 397
AluBI AGCT 2 cut(s) 7, 210
AluI AGCT 2 cut(s) 7, 210
AlwI GGATC 1 cut(s) 224
ApoI RAATTY 5 cut(s) 15, 92, 203, 278, 387
BccI CCATC 1 cut(s) 353
BceAI ACGGC 1 cut(s) 234
BcgI CGANNNNNNTGC 2 cut(s) 254, 288
BciT130I CCWGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 44
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 74
Bsa29I ATCGAT 1 cut(s) 68
BsaBI GATNNNNATC 2 cut(s) 221, 309
BsaJI CCNNGG 1 cut(s) 80
Bse3DI GCAATG 3 cut(s) 36, 67, 334
Bse8I GATNNNNATC 2 cut(s) 221, 309
BseBI CCWGG 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 364
BseJI GATNNNNATC 2 cut(s) 221, 309
BseMI GCAATG 3 cut(s) 36, 67, 334
BseYI CCCAGC 1 cut(s) 7
BshVI ATCGAT 1 cut(s) 68
BslFI GGGAC 2 cut(s) 24, 97
BsmFI GGGAC 2 cut(s) 24, 97
Bsp143I GATC 2 cut(s) 216, 331
BspDI ATCGAT 1 cut(s) 68
BspPI GGATC 1 cut(s) 224
BsrDI GCAATG 3 cut(s) 36, 67, 334
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 2 cut(s) 216, 331
BssNAI GTATAC 1 cut(s) 367
Bst1107I GTATAC 1 cut(s) 367
Bst2UI CCWGG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 273
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 364
BstKTI GATC 2 cut(s) 219, 334
BstMBI GATC 2 cut(s) 216, 331
BstNI CCWGG 1 cut(s) 81
BstNSI RCATGY 1 cut(s) 275
BstSCI CCNGG 1 cut(s) 79
BstZ17I GTATAC 1 cut(s) 367
Bsu15I ATCGAT 1 cut(s) 68
BsuTUI ATCGAT 1 cut(s) 68
BtsCI GGATG 1 cut(s) 364
Cac8I GCNNGC 1 cut(s) 273
ClaI ATCGAT 1 cut(s) 68
Csp6I GTAC 1 cut(s) 98
CviAII CATG 1 cut(s) 272
CviJI RGCY 4 cut(s) 7, 47, 210, 350
CviKI_1 RGCY 4 cut(s) 7, 47, 210, 350
CviQI GTAC 1 cut(s) 98
DdeI CTNAG 1 cut(s) 116
DpnI GATC 2 cut(s) 218, 333
DpnII GATC 2 cut(s) 216, 331
DraI TTTAAA 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 79
EcoT22I ATGCAT 1 cut(s) 67
FaeI CATG 1 cut(s) 275
FaiI YATR 6 cut(s) 256, 273, 303, 341, 343, 367
FaqI GGGAC 2 cut(s) 24, 97
FatI CATG 1 cut(s) 271
FauNDI CATATG 1 cut(s) 341
FblI GTMKAC 1 cut(s) 366
FokI GGATG 1 cut(s) 371
FspBI CTAG 1 cut(s) 44
GsaI CCCAGC 1 cut(s) 11
Hin1II CATG 1 cut(s) 275
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
Hpy166II GTNNAC 2 cut(s) 109, 367
Hpy188I TCNGA 2 cut(s) 216, 265
Hpy188III TCNNGA 1 cut(s) 314
Hpy8I GTNNAC 2 cut(s) 109, 367
HpyCH4V TGCA 4 cut(s) 65, 275, 287, 339
HpyF3I CTNAG 1 cut(s) 116
Hsp92II CATG 1 cut(s) 275
Kzo9I GATC 2 cut(s) 216, 331
LpnPI CCDG 3 cut(s) 66, 93, 211
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 44
MalI GATC 2 cut(s) 218, 333
MboI GATC 2 cut(s) 216, 331
MluCI AATT 8 cut(s) 15, 92, 136, 203, 278, 380, 387, 403
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 1 cut(s) 349
Mph1103I ATGCAT 1 cut(s) 67
MseI TTAA 3 cut(s) 135, 291, 406
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeI CATATG 1 cut(s) 341
NdeII GATC 2 cut(s) 216, 331
NlaIII CATG 1 cut(s) 275
NsiI ATGCAT 1 cut(s) 67
NspI RCATGY 1 cut(s) 275
PaeI GCATGC 1 cut(s) 275
Psp6I CCWGG 1 cut(s) 79
PspFI CCCAGC 1 cut(s) 7
PspGI CCWGG 1 cut(s) 79
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 3 cut(s) 135, 291, 406
Sau3AI GATC 2 cut(s) 216, 331
ScrFI CCNGG 1 cut(s) 81
SetI ASST 2 cut(s) 9, 212
SfaNI GCATC 1 cut(s) 74
SphI GCATGC 1 cut(s) 275
Sse9I AATT 8 cut(s) 15, 92, 136, 203, 278, 380, 387, 403
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 79
TaqI TCGA 1 cut(s) 68
TasI AATT 8 cut(s) 15, 92, 136, 203, 278, 380, 387, 403
Tru1I TTAA 3 cut(s) 135, 291, 406
Tru9I TTAA 3 cut(s) 135, 291, 406
TspDTI ATGAA 3 cut(s) 17, 131, 393
XapI RAATTY 5 cut(s) 15, 92, 203, 278, 387
XceI RCATGY 1 cut(s) 275
XmiI GTMKAC 1 cut(s) 366
XspI CTAG 1 cut(s) 44
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.