Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007168.1

Orthogroup ID

OG0004567

Physical Location & Seq

Genomic Coordinates Reverse (-)

48798 .. 49217

Gene Structure 420 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007168.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 420 bp

atgaagggaagctcaacatggcacttctattgttttgtggggctaagcaacagcaagtttatcattggccacaagtattttgttcgtatggttagcaatatcaatgacaaagatgcattccactttacttgtcagtcaggtgacgatactataggtcctcgtgaacttgctcccaatcaagagtggaaatggggattctgggtaagcttcggaacaaggtttgagtgcataaattggtaccagagtagcagcgggggtccgaatcacataactgcgtcgttcgactcgtttagtcagtatgacactcctcaatatggtggtgttcatgcgatatggagcgcacgggacaccggaatgtggttgttcaaaggttccttaattggtaagaaaagattatttagcttgtcgcagtcgttgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

139

Amino Acids

15.9

Weight (kDa)

8.83

Isoelectric Point (pI)

37.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004567)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G08560 AT5G43090 AT5G43110
fragaria_vesca	FvH4_1g17330 FvH4_4g05642 FvH4_6g00810
prunus_persica	Prupe.1G043900_v2.0.a1 Prupe.1G059500_v2.0.a1 Prupe.1G059700_v2.0.a1 Prupe.1G060000_v2.0.a1 Prupe.1G060100_v2.0.a1 Prupe.4G236000_v2.0.a1
pyrus_communis	pycom05g24890
rosa_chinensis	RchiOBHm_Chr3g0448291 RchiOBHm_Chr3g0448331
rosa_laevigata	RLG00000017575 RLG00000017576 RLG00000025927
rosa_multiflora	Rmu_sc0007168.1_g000011 Rmu_sc0010952.1_g000002
rosa_roxburghii	Rroxscaffold_4G00301640 Rroxscaffold_5G00341650
rosa_rugosa	Rorug02G0610600 Rorug03G0347600
rosa_samantha	Rh1CG232900 Rh2AG193400 Rh3AG010100 Rh3BG009700 Rh3CG009600 Rh3DG010200
rosa_wichuraiana	Rw3G000810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	237
AccB1I	GGYRCC	1 cut(s)	237
AciI	CCGC	1 cut(s)	252
AcoI	YGGCCR	1 cut(s)	67
AfaI	GTAC	1 cut(s)	239
AfiI	CCNNNNNNNGG	2 cut(s)	314, 357
AgsI	TTSAA	1 cut(s)	367
AluBI	AGCT	3 cut(s)	12, 207, 402
AluI	AGCT	3 cut(s)	12, 207, 402
AoxI	GGCC	1 cut(s)	67
ApeKI	GCWGC	1 cut(s)	249
Asp718I	GGTACC	1 cut(s)	237
AspLEI	GCGC	1 cut(s)	341
AspS9I	GGNCC	2 cut(s)	155, 257
AsuHPI	GGTGA	1 cut(s)	152
AvaII	GGWCC	2 cut(s)	155, 257
BaeI	ACNNNNGTAYC	2 cut(s)	229, 262
BalI	TGGCCA	1 cut(s)	69
BanI	GGYRCC	1 cut(s)	237
BauI	CACGAG	1 cut(s)	159
BbvI	GCAGC	1 cut(s)	261
BfmI	CTRYAG	1 cut(s)	150
BisI	GCNGC	1 cut(s)	250
BlpI	GCTNAGC	1 cut(s)	44
BlsI	GCNGC	1 cut(s)	251
Bme18I	GGWCC	2 cut(s)	155, 257
BmgT120I	GGNCC	2 cut(s)	155, 257
BmiI	GGNNCC	3 cut(s)	239, 258, 373
BmsI	GCATC	1 cut(s)	103
Bpu1102I	GCTNAGC	1 cut(s)	44
BsaWI	WCCGGW	1 cut(s)	350
Bsc4I	CCNNNNNNNGG	2 cut(s)	314, 357
BseLI	CCNNNNNNNGG	2 cut(s)	314, 357
BseRI	GAGGAG	1 cut(s)	297
BseXI	GCAGC	1 cut(s)	261
BshFI	GGCC	1 cut(s)	69
BshNI	GGYRCC	1 cut(s)	237
BsiSI	CCGG	1 cut(s)	351
BslFI	GGGAC	1 cut(s)	359
BslI	CCNNNNNNNGG	2 cut(s)	314, 357
BsmFI	GGGAC	1 cut(s)	359
BsmI	GAATGC	1 cut(s)	116
BsnI	GGCC	1 cut(s)	69
Bsp1720I	GCTNAGC	1 cut(s)	44
BspACI	CCGC	1 cut(s)	252
BspANI	GGCC	1 cut(s)	69
BspLI	GGNNCC	3 cut(s)	239, 258, 373
BspT107I	GGYRCC	1 cut(s)	237
BssSI	CACGAG	1 cut(s)	159
Bst2BI	CACGAG	1 cut(s)	159
BstDEI	CTNAG	1 cut(s)	44
BstHHI	GCGC	1 cut(s)	341
BstSFI	CTRYAG	1 cut(s)	150
BstV1I	GCAGC	1 cut(s)	261
BsuRI	GGCC	1 cut(s)	69
CfoI	GCGC	1 cut(s)	341
Cfr13I	GGNCC	2 cut(s)	155, 257
CseI	GACGC	1 cut(s)	264
Csp6I	GTAC	1 cut(s)	238
CspCI	CAANNNNNGTGG	2 cut(s)	110, 145
CviAII	CATG	2 cut(s)	18, 326
CviJI	RGCY	5 cut(s)	12, 43, 69, 207, 402
CviKI_1	RGCY	5 cut(s)	12, 43, 69, 207, 402
CviQI	GTAC	1 cut(s)	238
DdeI	CTNAG	1 cut(s)	44
EaeI	YGGCCR	1 cut(s)	67
Eco47I	GGWCC	2 cut(s)	155, 257
EcoO109I	RGGNCCY	1 cut(s)	155
EcoT22I	ATGCAT	1 cut(s)	118
FaeI	CATG	2 cut(s)	21, 329
FaiI	YATR	9 cut(s)	19, 89, 152, 230, 269, 300, 315, 327, 334
FaqI	GGGAC	1 cut(s)	359
FatI	CATG	2 cut(s)	17, 325
FauI	CCCGC	1 cut(s)	245
Fnu4HI	GCNGC	1 cut(s)	250
Fsp4HI	GCNGC	1 cut(s)	250
GlaI	GCGC	1 cut(s)	340
GluI	GCNGC	1 cut(s)	250
HaeIII	GGCC	1 cut(s)	69
HapII	CCGG	1 cut(s)	351
HgaI	GACGC	1 cut(s)	264
HhaI	GCGC	1 cut(s)	341
Hin1II	CATG	2 cut(s)	21, 329
Hin6I	GCGC	1 cut(s)	339
HinP1I	GCGC	1 cut(s)	339
HindIII	AAGCTT	1 cut(s)	205
HinfI	GANTC	3 cut(s)	195, 262, 284
HpaII	CCGG	1 cut(s)	351
HphI	GGTGA	1 cut(s)	152
Hpy166II	GTNNAC	1 cut(s)	164
Hpy188I	TCNGA	2 cut(s)	212, 261
Hpy188III	TCNNGA	2 cut(s)	161, 179
Hpy8I	GTNNAC	1 cut(s)	164
Hpy99I	CGWCG	1 cut(s)	280
HpyCH4V	TGCA	2 cut(s)	116, 228
HpyF3I	CTNAG	1 cut(s)	44
Hsp92II	CATG	2 cut(s)	21, 329
HspAI	GCGC	1 cut(s)	339
KpnI	GGTACC	1 cut(s)	241
LmnI	GCTCC	2 cut(s)	175, 336
LpnPI	CCDG	4 cut(s)	123, 184, 254, 364
Lsp1109I	GCAGC	1 cut(s)	261
LweI	GCATC	1 cut(s)	103
MaeIII	GTNAC	1 cut(s)	140
MlsI	TGGCCA	1 cut(s)	69
MluCI	AATT	2 cut(s)	232, 378
MluNI	TGGCCA	1 cut(s)	69
MlyI	GAGTC	1 cut(s)	278
MnlI	CCTC	2 cut(s)	168, 318
Mox20I	TGGCCA	1 cut(s)	69
Mph1103I	ATGCAT	1 cut(s)	118
MscI	TGGCCA	1 cut(s)	69
MseI	TTAA	1 cut(s)	377
MslI	CAYNNNNRTG	1 cut(s)	353
Msp20I	TGGCCA	1 cut(s)	69
MspA1I	CMGCKG	1 cut(s)	252
MspI	CCGG	1 cut(s)	351
Mva1269I	GAATGC	1 cut(s)	116
NlaIII	CATG	2 cut(s)	21, 329
NlaIV	GGNNCC	3 cut(s)	239, 258, 373
NmuCI	GTSAC	1 cut(s)	140
NsiI	ATGCAT	1 cut(s)	118
PcsI	WCGNNNNNNNCGW	1 cut(s)	284
PctI	GAATGC	1 cut(s)	116
PfeI	GAWTC	2 cut(s)	195, 262
PkrI	GCNGC	1 cut(s)	251
PleI	GAGTC	1 cut(s)	278
PpsI	GAGTC	1 cut(s)	278
PpuMI	RGGWCCY	1 cut(s)	155
Psp5II	RGGWCCY	1 cut(s)	155
PspN4I	GGNNCC	3 cut(s)	239, 258, 373
PspPI	GGNCC	2 cut(s)	155, 257
PspPPI	RGGWCCY	1 cut(s)	155
RsaI	GTAC	1 cut(s)	239
RsaNI	GTAC	1 cut(s)	238
RseI	CAYNNNNRTG	1 cut(s)	353
SaqAI	TTAA	1 cut(s)	377
SatI	GCNGC	1 cut(s)	250
Sau96I	GGNCC	2 cut(s)	155, 257
SchI	GAGTC	1 cut(s)	278
SetI	ASST	7 cut(s)	14, 142, 157, 209, 221, 373, 404
SfaNI	GCATC	1 cut(s)	103
SfcI	CTRYAG	1 cut(s)	150
SinI	GGWCC	2 cut(s)	155, 257
SmiMI	CAYNNNNRTG	1 cut(s)	353
Sse9I	AATT	2 cut(s)	232, 378
SsiI	CCGC	1 cut(s)	252
TaqI	TCGA	1 cut(s)	282
TasI	AATT	2 cut(s)	232, 378
TfiI	GAWTC	2 cut(s)	195, 262
Tru1I	TTAA	1 cut(s)	377
Tru9I	TTAA	1 cut(s)	377
TseFI	GTSAC	1 cut(s)	140
TseI	GCWGC	1 cut(s)	249
Tsp45I	GTSAC	1 cut(s)	140
TspDTI	ATGAA	2 cut(s)	17, 314
VpaK11BI	GGWCC	2 cut(s)	155, 257
Zsp2I	ATGCAT	1 cut(s)	118

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.