Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010952.1

Orthogroup ID

OG0004567

Physical Location & Seq

Genomic Coordinates Forward (+)

4633 .. 5073

Gene Structure 441 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010952.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

atgcatgaattcacagtggattcagaaatattgggttgggtatcagaaaatatgaagggaagctcaacatggcacttctattgttttgtggggctaagcaacagcaagtttatcattggccacaagtattttgttcgtatggttagcaatatcaatgacaaagatgcattccactttacttgtcagtcaggtgacgatactataggtcctcgtgaacttgctcccaatcaagagtggaaatggggattctgggtaagcttcggaacaaggtttgagtgcataaattggtaccagagtagcagcgggggtccgaatcacataactgcgtcgttcgactcgtttagtcagtatgacactcctcaatatggtggtgtacgttcatgcgatatggagcgcacgggacaccggaatgtggttgttcaaaggttccttaattggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Self-incomp_S1

Protein Analysis

146

Amino Acids

16.95

Weight (kDa)

6.03

Isoelectric Point (pI)

48.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004567)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G08560 AT5G43090 AT5G43110
fragaria_vesca	FvH4_1g17330 FvH4_4g05642 FvH4_6g00810
prunus_persica	Prupe.1G043900_v2.0.a1 Prupe.1G059500_v2.0.a1 Prupe.1G059700_v2.0.a1 Prupe.1G060000_v2.0.a1 Prupe.1G060100_v2.0.a1 Prupe.4G236000_v2.0.a1
pyrus_communis	pycom05g24890
rosa_chinensis	RchiOBHm_Chr3g0448291 RchiOBHm_Chr3g0448331
rosa_laevigata	RLG00000017575 RLG00000017576 RLG00000025927
rosa_multiflora	Rmu_sc0007168.1_g000011 Rmu_sc0010952.1_g000002
rosa_roxburghii	Rroxscaffold_4G00301640 Rroxscaffold_5G00341650
rosa_rugosa	Rorug02G0610600 Rorug03G0347600
rosa_samantha	Rh1CG232900 Rh2AG193400 Rh3AG010100 Rh3BG009700 Rh3CG009600 Rh3DG010200
rosa_wichuraiana	Rw3G000810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	288
AccB1I	GGYRCC	1 cut(s)	288
AciI	CCGC	1 cut(s)	303
AcoI	YGGCCR	1 cut(s)	118
AcsI	RAATTY	1 cut(s)	8
AfaI	GTAC	2 cut(s)	290, 375
AfiI	CCNNNNNNNGG	2 cut(s)	365, 412
AgsI	TTSAA	1 cut(s)	422
AluBI	AGCT	2 cut(s)	63, 258
AluI	AGCT	2 cut(s)	63, 258
AoxI	GGCC	1 cut(s)	118
ApeKI	GCWGC	1 cut(s)	300
ApoI	RAATTY	1 cut(s)	8
Asp718I	GGTACC	1 cut(s)	288
AspLEI	GCGC	1 cut(s)	396
AspS9I	GGNCC	2 cut(s)	206, 308
AsuHPI	GGTGA	1 cut(s)	203
AvaII	GGWCC	2 cut(s)	206, 308
BaeI	ACNNNNGTAYC	2 cut(s)	280, 313
BalI	TGGCCA	1 cut(s)	120
BanI	GGYRCC	1 cut(s)	288
BauI	CACGAG	1 cut(s)	210
BbvI	GCAGC	1 cut(s)	312
BfmI	CTRYAG	1 cut(s)	201
BisI	GCNGC	1 cut(s)	301
BlpI	GCTNAGC	1 cut(s)	95
BlsI	GCNGC	1 cut(s)	302
Bme18I	GGWCC	2 cut(s)	206, 308
BmgT120I	GGNCC	2 cut(s)	206, 308
BmiI	GGNNCC	3 cut(s)	290, 309, 428
BmsI	GCATC	1 cut(s)	154
Bpu1102I	GCTNAGC	1 cut(s)	95
BsaWI	WCCGGW	1 cut(s)	405
Bsc4I	CCNNNNNNNGG	2 cut(s)	365, 412
BseLI	CCNNNNNNNGG	2 cut(s)	365, 412
BseRI	GAGGAG	1 cut(s)	348
BseXI	GCAGC	1 cut(s)	312
BshFI	GGCC	1 cut(s)	120
BshNI	GGYRCC	1 cut(s)	288
BsiSI	CCGG	1 cut(s)	406
BslFI	GGGAC	1 cut(s)	414
BslI	CCNNNNNNNGG	2 cut(s)	365, 412
BsmFI	GGGAC	1 cut(s)	414
BsmI	GAATGC	1 cut(s)	167
BsnI	GGCC	1 cut(s)	120
Bsp1720I	GCTNAGC	1 cut(s)	95
BspACI	CCGC	1 cut(s)	303
BspANI	GGCC	1 cut(s)	120
BspLI	GGNNCC	3 cut(s)	290, 309, 428
BspT107I	GGYRCC	1 cut(s)	288
BssSI	CACGAG	1 cut(s)	210
Bst2BI	CACGAG	1 cut(s)	210
Bst4CI	ACNGT	1 cut(s)	16
BstDEI	CTNAG	1 cut(s)	95
BstHHI	GCGC	1 cut(s)	396
BstSFI	CTRYAG	1 cut(s)	201
BstV1I	GCAGC	1 cut(s)	312
BsuRI	GGCC	1 cut(s)	120
BtsIMutI	CAGTG	1 cut(s)	21
CfoI	GCGC	1 cut(s)	396
Cfr13I	GGNCC	2 cut(s)	206, 308
CseI	GACGC	1 cut(s)	315
Csp6I	GTAC	2 cut(s)	289, 374
CspCI	CAANNNNNGTGG	2 cut(s)	161, 196
CviAII	CATG	3 cut(s)	5, 69, 381
CviJI	RGCY	4 cut(s)	63, 94, 120, 258
CviKI_1	RGCY	4 cut(s)	63, 94, 120, 258
CviQI	GTAC	2 cut(s)	289, 374
DdeI	CTNAG	1 cut(s)	95
EaeI	YGGCCR	1 cut(s)	118
Eco47I	GGWCC	2 cut(s)	206, 308
EcoO109I	RGGNCCY	1 cut(s)	206
EcoRI	GAATTC	1 cut(s)	8
EcoT22I	ATGCAT	2 cut(s)	6, 169
FaeI	CATG	3 cut(s)	8, 72, 384
FaqI	GGGAC	1 cut(s)	414
FatI	CATG	3 cut(s)	4, 68, 380
FauI	CCCGC	1 cut(s)	296
Fnu4HI	GCNGC	1 cut(s)	301
Fsp4HI	GCNGC	1 cut(s)	301
GlaI	GCGC	1 cut(s)	395
GluI	GCNGC	1 cut(s)	301
HaeIII	GGCC	1 cut(s)	120
HapII	CCGG	1 cut(s)	406
HgaI	GACGC	1 cut(s)	315
HhaI	GCGC	1 cut(s)	396
Hin1II	CATG	3 cut(s)	8, 72, 384
Hin6I	GCGC	1 cut(s)	394
HinP1I	GCGC	1 cut(s)	394
HindIII	AAGCTT	1 cut(s)	256
HinfI	GANTC	4 cut(s)	20, 246, 313, 335
HpaII	CCGG	1 cut(s)	406
HphI	GGTGA	1 cut(s)	203
Hpy166II	GTNNAC	2 cut(s)	215, 374
Hpy188I	TCNGA	4 cut(s)	25, 46, 263, 312
Hpy188III	TCNNGA	2 cut(s)	212, 230
Hpy8I	GTNNAC	2 cut(s)	215, 374
Hpy99I	CGWCG	1 cut(s)	331
HpyAV	CCTTC	1 cut(s)	49
HpyCH4III	ACNGT	1 cut(s)	16
HpyCH4IV	ACGT	1 cut(s)	376
HpyCH4V	TGCA	3 cut(s)	4, 167, 279
HpyF3I	CTNAG	1 cut(s)	95
HpySE526I	ACGT	1 cut(s)	376
Hsp92II	CATG	3 cut(s)	8, 72, 384
HspAI	GCGC	1 cut(s)	394
KpnI	GGTACC	1 cut(s)	292
LmnI	GCTCC	2 cut(s)	226, 391
LpnPI	CCDG	4 cut(s)	174, 235, 305, 419
Lsp1109I	GCAGC	1 cut(s)	312
LweI	GCATC	1 cut(s)	154
MaeII	ACGT	1 cut(s)	376
MaeIII	GTNAC	1 cut(s)	191
MlsI	TGGCCA	1 cut(s)	120
MluCI	AATT	3 cut(s)	8, 283, 433
MluNI	TGGCCA	1 cut(s)	120
MlyI	GAGTC	1 cut(s)	329
MnlI	CCTC	2 cut(s)	219, 369
Mox20I	TGGCCA	1 cut(s)	120
Mph1103I	ATGCAT	2 cut(s)	6, 169
MscI	TGGCCA	1 cut(s)	120
MseI	TTAA	1 cut(s)	432
MslI	CAYNNNNRTG	1 cut(s)	408
Msp20I	TGGCCA	1 cut(s)	120
MspA1I	CMGCKG	1 cut(s)	303
MspI	CCGG	1 cut(s)	406
Mva1269I	GAATGC	1 cut(s)	167
NlaIII	CATG	3 cut(s)	8, 72, 384
NlaIV	GGNNCC	3 cut(s)	290, 309, 428
NmuCI	GTSAC	1 cut(s)	191
NsiI	ATGCAT	2 cut(s)	6, 169
PcsI	WCGNNNNNNNCGW	1 cut(s)	335
PctI	GAATGC	1 cut(s)	167
PfeI	GAWTC	3 cut(s)	20, 246, 313
PkrI	GCNGC	1 cut(s)	302
PleI	GAGTC	1 cut(s)	329
PpsI	GAGTC	1 cut(s)	329
PpuMI	RGGWCCY	1 cut(s)	206
Psp5II	RGGWCCY	1 cut(s)	206
PspN4I	GGNNCC	3 cut(s)	290, 309, 428
PspPI	GGNCC	2 cut(s)	206, 308
PspPPI	RGGWCCY	1 cut(s)	206
RsaI	GTAC	2 cut(s)	290, 375
RsaNI	GTAC	2 cut(s)	289, 374
RseI	CAYNNNNRTG	1 cut(s)	408
SaqAI	TTAA	1 cut(s)	432
SatI	GCNGC	1 cut(s)	301
Sau96I	GGNCC	2 cut(s)	206, 308
SchI	GAGTC	1 cut(s)	329
SetI	ASST	7 cut(s)	65, 193, 208, 260, 272, 379, 428
SfaNI	GCATC	1 cut(s)	154
SfcI	CTRYAG	1 cut(s)	201
SinI	GGWCC	2 cut(s)	206, 308
SmiMI	CAYNNNNRTG	1 cut(s)	408
Sse9I	AATT	3 cut(s)	8, 283, 433
SsiI	CCGC	1 cut(s)	303
SspI	AATATT	1 cut(s)	30
TaaI	ACNGT	1 cut(s)	16
TaiI	ACGT	1 cut(s)	379
TaqI	TCGA	1 cut(s)	333
TasI	AATT	3 cut(s)	8, 283, 433
TfiI	GAWTC	3 cut(s)	20, 246, 313
Tru1I	TTAA	1 cut(s)	432
Tru9I	TTAA	1 cut(s)	432
TscAI	CASTG	1 cut(s)	21
TseFI	GTSAC	1 cut(s)	191
TseI	GCWGC	1 cut(s)	300
Tsp45I	GTSAC	1 cut(s)	191
TspDTI	ATGAA	3 cut(s)	21, 68, 369
TspRI	CASTG	1 cut(s)	21
VpaK11BI	GGWCC	2 cut(s)	206, 308
XapI	RAATTY	1 cut(s)	8
Zsp2I	ATGCAT	2 cut(s)	6, 169

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.