RchiOBHm_Chr4g0395121

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
10902375 .. 10909407
7033 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36758

Sequence Viewer

Length: 153 bp
ATGGTCGAGATGGTCATAGCTCCATTTCCTGATGTTATTCGTCCCGACTCCGATTTTGGTTATGATGGTAGCGATGTAGAACCCCTACTGTCACTCCCAGGAGTCGGAGATTTCGGTCCTCCTTCGCCGGATGTAATCTATGATCCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.42

Weight (kDa)

4.05

Isoelectric Point (pI)

51.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 104
AjnI CCWGG 1 cut(s) 97
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AlwI GGATC 1 cut(s) 137
ArsI GACNNNNNNTTYG 2 cut(s) 38, 70
AspS9I GGNCC 1 cut(s) 116
AvaII GGWCC 1 cut(s) 116
BccI CCATC 2 cut(s) 4, 59
BciT130I CCWGG 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 99
Bme18I GGWCC 1 cut(s) 116
BmgT120I GGNCC 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 97, 146
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 104
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 2 cut(s) 97, 146
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 128
BslFI GGGAC 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 104
BsmFI GGGAC 1 cut(s) 27
Bsp143I GATC 1 cut(s) 142
BspPI GGATC 1 cut(s) 137
BssECI CCNNGG 2 cut(s) 97, 146
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 146
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 90
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BtgZI GCGATG 1 cut(s) 87
BtsCI GGATG 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 116
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 97
EcoT14I CCWWGG 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 146
FaiI YATR 3 cut(s) 17, 63, 141
FaqI GGGAC 1 cut(s) 27
FokI GGATG 1 cut(s) 143
HapII CCGG 1 cut(s) 128
HinfI GANTC 2 cut(s) 47, 102
HpaII CCGG 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 52, 107
Hpy188III TCNNGA 3 cut(s) 7, 29, 44
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 1 cut(s) 90
Kzo9I GATC 1 cut(s) 142
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 4 cut(s) 42, 84, 111, 141
MaeIII GTNAC 1 cut(s) 90
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MlyI GAGTC 2 cut(s) 41, 111
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 1 cut(s) 129
MspI CCGG 1 cut(s) 128
MspR9I CCNGG 1 cut(s) 99
MvaI CCWGG 1 cut(s) 99
NdeII GATC 1 cut(s) 142
NmuCI GTSAC 1 cut(s) 90
PleI GAGTC 2 cut(s) 41, 110
PpsI GAGTC 2 cut(s) 41, 110
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspPI GGNCC 1 cut(s) 116
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 116
SchI GAGTC 2 cut(s) 41, 111
ScrFI CCNGG 1 cut(s) 99
SetI ASST 1 cut(s) 22
SgeI CNNG 6 cut(s) 19, 41, 56, 110, 111, 140
SinI GGWCC 1 cut(s) 116
StyD4I CCNGG 1 cut(s) 97
StyI CCWWGG 1 cut(s) 146
TaaI ACNGT 1 cut(s) 90
TaqI TCGA 1 cut(s) 6
TaqII GACCGA 1 cut(s) 104
TseFI GTSAC 1 cut(s) 90
Tsp45I GTSAC 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.