Rmu_sc0007570.1_g000004

Caleosin related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007570.1
Physical Location & Seq
Reverse (-)
13836 .. 14195
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007570.1_g000004.1.cds

Sequence Viewer

Length: 255 bp
atgtttagcaagtatgctcgtatggttcctgacaagttcactctaggagagctttgggacatgactgagggaaacagagtttcatacgacttctttggatggattgcaagtaagctggaatggggacttctgtatgttctcgcaagggatgaggagggtttactatctaaagaagctgtgagacgctgctttgatggaagcttattcgagtattgtgccaagatgaatgcaagtgcagaagctaagatgggctga

Protein Analysis

84

Amino Acids

9.68

Weight (kDa)

5.07

Isoelectric Point (pI)

35.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 5 cut(s) 52, 115, 176, 201, 242
AluI AGCT 5 cut(s) 52, 115, 176, 201, 242
Alw26I GTCTC 1 cut(s) 175
ApeKI GCWGC 1 cut(s) 186
BbvI GCAGC 1 cut(s) 173
BccI CCATC 3 cut(s) 93, 188, 241
BcgI CGANNNNNNTGC 2 cut(s) 197, 231
BcoDI GTCTC 1 cut(s) 175
BfaI CTAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 187
BlsI GCNGC 1 cut(s) 188
BmiI GGNNCC 1 cut(s) 27
BseGI GGATG 2 cut(s) 104, 154
BseMII CTCAG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 167
BseXI GCAGC 1 cut(s) 173
BsgI GTGCAG 1 cut(s) 255
BslFI GGGAC 2 cut(s) 71, 138
BsmAI GTCTC 1 cut(s) 175
BsmBI CGTCTC 1 cut(s) 175
BsmFI GGGAC 2 cut(s) 71, 138
BsmI GAATGC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 27
BstDEI CTNAG 2 cut(s) 66, 243
BstF5I GGATG 2 cut(s) 104, 154
BstMAI GTCTC 1 cut(s) 175
BstV1I GCAGC 1 cut(s) 173
BtsCI GGATG 2 cut(s) 104, 154
CseI GACGC 1 cut(s) 192
CviAII CATG 1 cut(s) 61
CviJI RGCY 6 cut(s) 52, 115, 176, 201, 242, 252
CviKI_1 RGCY 6 cut(s) 52, 115, 176, 201, 242, 252
DdeI CTNAG 2 cut(s) 66, 243
Esp3I CGTCTC 1 cut(s) 175
FaeI CATG 1 cut(s) 64
FaiI YATR 5 cut(s) 15, 23, 62, 85, 135
FaqI GGGAC 2 cut(s) 71, 138
FatI CATG 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 187
FokI GGATG 2 cut(s) 111, 161
Fsp4HI GCNGC 1 cut(s) 187
FspBI CTAG 1 cut(s) 44
GluI GCNGC 1 cut(s) 187
HgaI GACGC 1 cut(s) 192
Hin1II CATG 1 cut(s) 64
HindIII AAGCTT 1 cut(s) 199
Hpy166II GTNNAC 2 cut(s) 39, 161
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 39, 161
HpyCH4V TGCA 3 cut(s) 107, 230, 236
HpyF3I CTNAG 2 cut(s) 66, 243
Hsp92II CATG 1 cut(s) 64
LpnPI CCDG 2 cut(s) 42, 101
Lsp1109I GCAGC 1 cut(s) 173
MaeI CTAG 1 cut(s) 44
MnlI CCTC 3 cut(s) 61, 145, 148
Mva1269I GAATGC 1 cut(s) 232
NlaIII CATG 1 cut(s) 64
NlaIV GGNNCC 1 cut(s) 27
PctI GAATGC 1 cut(s) 232
PkrI GCNGC 1 cut(s) 188
PspN4I GGNNCC 1 cut(s) 27
SatI GCNGC 1 cut(s) 187
SetI ASST 5 cut(s) 54, 117, 178, 203, 244
SspMI CTAG 1 cut(s) 44
TaqI TCGA 1 cut(s) 207
TseI GCWGC 1 cut(s) 186
TspDTI ATGAA 2 cut(s) 72, 239
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.