RchiOBHm_Chr4g0427301

Ubiquitin-like modifier-activating enzyme

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
52584633 .. 52587711
3079 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39623

Sequence Viewer

Length: 213 bp
ATGCTAATAAGATGTGGTGTTAATCGCATTCTGTTGTATGATTATGACAAAGTAGAGCTAGCTAACATGAATATGTTATTCTTTCGTCCAGATCGGAGCAAGTGCTCATCCCTATGCTCATATGTCTTTCTTTCTTTTTGGAATTTGCCTTTGTGCTCATTTGCCAGCAAACTGGTTCCCATATTTGAAATTTTGAATTACCATGATATATAG

Protein Analysis

70

Amino Acids

8.29

Weight (kDa)

7.65

Isoelectric Point (pI)

39.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 142, 189
AgsI TTSAA 2 cut(s) 188, 196
AluBI AGCT 2 cut(s) 58, 62
AluI AGCT 2 cut(s) 58, 62
Alw21I GWGCWC 2 cut(s) 107, 158
ApoI RAATTY 2 cut(s) 142, 189
AsuNHI GCTAGC 1 cut(s) 58
Bbv12I GWGCWC 2 cut(s) 107, 158
BfaI CTAG 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 177
BmtI GCTAGC 1 cut(s) 62
Bse1I ACTGG 1 cut(s) 177
BseGI GGATG 1 cut(s) 107
BseNI ACTGG 1 cut(s) 177
BsiHKAI GWGCWC 2 cut(s) 107, 158
BsmI GAATGC 1 cut(s) 27
Bsp1286I GDGCHC 2 cut(s) 107, 158
Bsp143I GATC 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 177
BspOI GCTAGC 1 cut(s) 62
BsrI ACTGG 1 cut(s) 177
BssMI GATC 1 cut(s) 91
BstC8I GCNNGC 2 cut(s) 60, 166
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstXI CCANNNNNNTGG 1 cut(s) 172
BtsCI GGATG 1 cut(s) 107
Cac8I GCNNGC 2 cut(s) 60, 166
CviAII CATG 2 cut(s) 67, 203
CviJI RGCY 2 cut(s) 58, 62
CviKI_1 RGCY 2 cut(s) 58, 62
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaeI CATG 2 cut(s) 70, 206
FatI CATG 2 cut(s) 66, 202
FauNDI CATATG 1 cut(s) 121
FokI GGATG 1 cut(s) 94
FspBI CTAG 1 cut(s) 59
Hin1II CATG 2 cut(s) 70, 206
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 89
Hsp92II CATG 2 cut(s) 70, 206
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 3 cut(s) 102, 158, 178
MaeI CTAG 1 cut(s) 59
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MhlI GDGCHC 2 cut(s) 107, 158
MluCI AATT 3 cut(s) 142, 189, 196
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 2 cut(s) 71, 112
Mva1269I GAATGC 1 cut(s) 27
NdeI CATATG 1 cut(s) 121
NdeII GATC 1 cut(s) 91
NheI GCTAGC 1 cut(s) 58
NlaIII CATG 2 cut(s) 70, 206
NlaIV GGNNCC 1 cut(s) 177
PctI GAATGC 1 cut(s) 27
PspN4I GGNNCC 1 cut(s) 177
RseI CAYNNNNRTG 2 cut(s) 71, 112
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 1 cut(s) 91
SduI GDGCHC 2 cut(s) 107, 158
SetI ASST 2 cut(s) 60, 64
SgeI CNNG 6 cut(s) 71, 79, 101, 112, 177, 185
SmiMI CAYNNNNRTG 2 cut(s) 71, 112
Sse9I AATT 3 cut(s) 142, 189, 196
SspMI CTAG 1 cut(s) 59
TasI AATT 3 cut(s) 142, 189, 196
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 83
XapI RAATTY 2 cut(s) 142, 189
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.