Rroxscaffold_7G00186790

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
26158801 .. 26159438
638 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00186790.1

Sequence Viewer

Length: 297 bp
ATGTCTGGCCAAAATTCTTCAAGGAATGAACTGGCTATGGAACTTACCTGGCTTAGACAGAGGAAAGAACAATTGCAAGCTCAATATGCTGCTCAAATTTCTAAACTAGCTGCTCTCGAGAGAGAGGAATATATCCTTAAAGATTTAAACATCAAATTAAAAGAACACGAGAACGATTTGCAAGTACAGATCAAACTGGAAGATGCCTTGATTGAAGAAACCAAAAAGGAGCACAAGTTATTGATGAAGATATTGAGTGGGAAAGAGTTTGCACATGATACGACTAGTTCAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.41

Weight (kDa)

5.92

Isoelectric Point (pI)

46.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 7
AcsI RAATTY 2 cut(s) 13, 96
AfaI GTAC 1 cut(s) 186
AgsI TTSAA 3 cut(s) 21, 215, 291
AhlI ACTAGT 1 cut(s) 284
AjnI CCWGG 1 cut(s) 47
AluBI AGCT 2 cut(s) 80, 110
AluI AGCT 2 cut(s) 80, 110
Alw21I GWGCWC 1 cut(s) 234
Ama87I CYCGRG 1 cut(s) 116
AoxI GGCC 1 cut(s) 7
ApeKI GCWGC 2 cut(s) 89, 110
ApoI RAATTY 2 cut(s) 13, 96
AvaI CYCGRG 1 cut(s) 116
BalI TGGCCA 1 cut(s) 9
BauI CACGAG 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 234
BbvI GCAGC 2 cut(s) 76, 97
BciT130I CCWGG 1 cut(s) 49
BcuI ACTAGT 1 cut(s) 284
BfaI CTAG 2 cut(s) 107, 285
BisI GCNGC 2 cut(s) 90, 111
BlsI GCNGC 2 cut(s) 91, 112
Bme1390I CCNGG 1 cut(s) 49
BmeT110I CYCGRG 1 cut(s) 116
BmrFI CCNGG 1 cut(s) 49
BmsI GCATC 1 cut(s) 193
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bse1I ACTGG 2 cut(s) 36, 201
BseBI CCWGG 1 cut(s) 49
BseNI ACTGG 2 cut(s) 36, 201
BseXI GCAGC 2 cut(s) 76, 97
BshFI GGCC 1 cut(s) 9
BsiHKAI GWGCWC 1 cut(s) 234
BsiHKCI CYCGRG 1 cut(s) 116
BsnI GGCC 1 cut(s) 9
BsoBI CYCGRG 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 234
Bsp143I GATC 1 cut(s) 189
BspANI GGCC 1 cut(s) 9
BsrI ACTGG 2 cut(s) 36, 201
BssMI GATC 1 cut(s) 189
BssSI CACGAG 1 cut(s) 167
Bst2BI CACGAG 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 49
BstC8I GCNNGC 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 53
BstKTI GATC 1 cut(s) 192
BstMBI GATC 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 49
BstSCI CCNGG 1 cut(s) 47
BstV1I GCAGC 2 cut(s) 76, 97
BsuRI GGCC 1 cut(s) 9
Cac8I GCNNGC 1 cut(s) 78
Csp6I GTAC 1 cut(s) 185
CviAII CATG 1 cut(s) 275
CviJI RGCY 5 cut(s) 9, 35, 52, 80, 110
CviKI_1 RGCY 5 cut(s) 9, 35, 52, 80, 110
CviQI GTAC 1 cut(s) 185
DdeI CTNAG 1 cut(s) 53
DpnI GATC 1 cut(s) 191
DpnII GATC 1 cut(s) 189
DraI TTTAAA 1 cut(s) 147
EaeI YGGCCR 1 cut(s) 7
Eco88I CYCGRG 1 cut(s) 116
EcoRII CCWGG 1 cut(s) 47
FaeI CATG 1 cut(s) 278
FaiI YATR 4 cut(s) 38, 87, 132, 276
FatI CATG 1 cut(s) 274
Fnu4HI GCNGC 2 cut(s) 90, 111
Fsp4HI GCNGC 2 cut(s) 90, 111
FspBI CTAG 2 cut(s) 107, 285
GluI GCNGC 2 cut(s) 90, 111
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 1 cut(s) 278
Hpy188III TCNNGA 2 cut(s) 116, 118
HpyCH4V TGCA 3 cut(s) 76, 181, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 53
Hsp92II CATG 1 cut(s) 278
Kzo9I GATC 1 cut(s) 189
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 17, 34, 61, 182
Lsp1109I GCAGC 2 cut(s) 76, 97
LweI GCATC 1 cut(s) 193
MaeI CTAG 2 cut(s) 107, 285
MalI GATC 1 cut(s) 191
MboI GATC 1 cut(s) 189
MboII GAAGA 4 cut(s) 9, 212, 227, 259
MfeI CAATTG 1 cut(s) 71
MhlI GDGCHC 1 cut(s) 234
MlsI TGGCCA 1 cut(s) 9
MluCI AATT 4 cut(s) 13, 71, 96, 155
MluNI TGGCCA 1 cut(s) 9
MnlI CCTC 2 cut(s) 54, 118
Mox20I TGGCCA 1 cut(s) 9
MscI TGGCCA 1 cut(s) 9
MseI TTAA 3 cut(s) 138, 146, 158
Msp20I TGGCCA 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 49
MunI CAATTG 1 cut(s) 71
MvaI CCWGG 1 cut(s) 49
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 1 cut(s) 189
NlaIII CATG 1 cut(s) 278
PaeR7I CTCGAG 1 cut(s) 116
PkrI GCNGC 2 cut(s) 91, 112
Psp6I CCWGG 1 cut(s) 47
PspGI CCWGG 1 cut(s) 47
RsaI GTAC 1 cut(s) 186
RsaNI GTAC 1 cut(s) 185
SaqAI TTAA 3 cut(s) 138, 146, 158
SatI GCNGC 2 cut(s) 90, 111
Sau3AI GATC 1 cut(s) 189
ScrFI CCNGG 1 cut(s) 49
SduI GDGCHC 1 cut(s) 234
SetI ASST 3 cut(s) 50, 82, 112
SfaNI GCATC 1 cut(s) 193
Sfr274I CTCGAG 1 cut(s) 116
SlaI CTCGAG 1 cut(s) 116
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
SpeI ACTAGT 1 cut(s) 284
Sse9I AATT 4 cut(s) 13, 71, 96, 155
SspMI CTAG 2 cut(s) 107, 285
StyD4I CCNGG 1 cut(s) 47
TaqI TCGA 1 cut(s) 117
TasI AATT 4 cut(s) 13, 71, 96, 155
TatI WGTACW 1 cut(s) 184
Tru1I TTAA 3 cut(s) 138, 146, 158
Tru9I TTAA 3 cut(s) 138, 146, 158
TseI GCWGC 2 cut(s) 89, 110
TspDTI ATGAA 2 cut(s) 42, 260
XapI RAATTY 2 cut(s) 13, 96
XhoI CTCGAG 1 cut(s) 116
XspI CTAG 2 cut(s) 107, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.